AppleGFDB:The Apple Gene Function & Gene Family DataBase v1.0
Locus Search:

 

miR319b

miR319b  

Mature Sequence:5'-TTGGATTGAAGGGAGCTC-3'

Precursor Sequence:

GAGCTCCTTGAAGTCCAAAAGAAGGTGATGCTGGGTGGATAGAGCTGCTGAGCTATGGAT
CCCAGAGTCCTATATATCCTATATCGCAGATCAGATCAGATGCGATCAGAAGGATGATAG
GCTTGTGGCTTGCATATCTCAGGAGCTGCATTACCTGTACGCTGCCTCTTTTTTTGGATT
GAAGGGAGCTC

Genome Location:UN
Precursor Coordinates:_
MFE:_
MFEI:_
GC:_
Plant Homologs:

_

Structure:
Data resource:
microPC

All copyright are reserved by Prof. Huairui Shu 's lab at National Research Center for Apple Engineering and Technology,Shandong Agricultrural University

Web Site Designing & Administration Shizhong Zhang,Guanghui Chen and Yukun Liu ; IE 8 & 1600×900 Resolution Suggested