AppleGFDB:The Apple Gene Function & Gene Family DataBase v1.0
Locus Search:

 

miR319e

miR319e  

Mature Sequence:5'-TTGGACTGAAGGGAGCTCCTT-3'

Precursor Sequence:

CTTCTTCAGTCCAGTCCTTGGCAGTTTAAGGGCTGGCACTCAGCTGCTGACTCGTTGGTT
CAAAAACTCATCATACATTTGCTAAAAGAAGTGGTGTTTTTCTGATCCAACGAAGCAGGA
GCCGAGAGGTTGGTTATTGCTGTCACGTCTTGGACTGAAGGGAGCTCCTTACCTATAATT
ATTCATTCCACAACTTCAAATTTATTTTCTTGGTAAAAAGA

Genome Location:Chr7:21385446..21385465
Precursor Coordinates:51..272
MFE:-75.76
MFEI:0.81
GC:42.08
Plant Homologs:

aly-miR319d;aly-miR319c;ath-miR319c;pvu-miR319c;gma-miR4414;rco-miR319d;

Structure:
Target:MDP0000757833 
Target Start:44 
Target End:63 
miRNA Aligned Fragment:5'-UUGGACUGAAGGGAGCUCCU-3' 
Target Aligned Fragment:3'- ACCUUGACUUCCUUUGAGGA -5' 
Inhibition Type:Cleavage 
MDP0000757833 
Target:MDP0000205544 
Target Start:610 
Target End:629 
miRNA Aligned Fragment:5'-UUGGACUGAAGGGAGCUCCU-3' 
Target Aligned Fragment:3'- CACCUGAGUUCCCUCGAGGC -5' 
Inhibition Type:Cleavage 
MDP0000205544 
Target:MDP0000237553 
Target Start:298 
Target End:317 
miRNA Aligned Fragment:5'-UUGGACUGAAGGGAGCUCCU-3' 
Target Aligned Fragment:3'- AACCUGACUUCCCAGGGGGA -5' 
Inhibition Type:Cleavage 
MDP0000237553 
Target:MDP0000442611 
Target Start:841 
Target End:860 
miRNA Aligned Fragment:5'-UUGGACUGAAGGGAGCUCCU-3' 
Target Aligned Fragment:3'- GACCUGACUUCCCAUGGGGG -5' 
Inhibition Type:Cleavage 
MDP0000442611 
Target:MDP0000328318 
Target Start:988 
Target End:1007 
miRNA Aligned Fragment:5'-UUGGACUGAAGGGAGCUCCU-3' 
Target Aligned Fragment:3'- GACCUGACUUCCCAUGGGGG -5' 
Inhibition Type:Cleavage 
MDP0000328318 
Target:MDP0000287069 
Target Start:1180 
Target End:1199 
miRNA Aligned Fragment:5'-UUGGACUGAAGGGAGCUCCU-3' 
Target Aligned Fragment:3'- AACCUGACUUCCCAGGGGGA -5' 
Inhibition Type:Cleavage 
MDP0000287069 
Target:MDP0000763497 
Target Start:1186 
Target End:1205 
miRNA Aligned Fragment:5'-UUGGACUGAAGGGAGCUCCU-3' 
Target Aligned Fragment:3'- AACCUGACUUCCCAGGGGGA -5' 
Inhibition Type:Cleavage 
MDP0000763497 
Target:MDP0000920127 
Target Start:1186 
Target End:1205 
miRNA Aligned Fragment:5'-UUGGACUGAAGGGAGCUCCU-3' 
Target Aligned Fragment:3'- AACCUGACUUCCCAGGGGGA -5' 
Inhibition Type:Cleavage 
MDP0000920127 
Target:MDP0000927314 
Target Start:1186 
Target End:1205 
miRNA Aligned Fragment:5'-UUGGACUGAAGGGAGCUCCU-3' 
Target Aligned Fragment:3'- AACCUGACUUCCCAGGGGGA -5' 
Inhibition Type:Cleavage 
MDP0000927314 
Target:MDP0000168665 
Target Start:2649 
Target End:2668 
miRNA Aligned Fragment:5'-UUGGACUGAAGGGAGCUCCU-3' 
Target Aligned Fragment:3'- AGCCUGGCUUACCUUGGGGA -5' 
Inhibition Type:Translation 
MDP0000168665 
Target:MDP0000194772 
Target Start:313 
Target End:332 
miRNA Aligned Fragment:5'-UUGGACUGAAGGGAGCUCCU-3' 
Target Aligned Fragment:3'- AACCUGACUUACUUCGGGUA -5' 
Inhibition Type:Translation 
MDP0000194772 
Target:MDP0000189746 
Target Start:1226 
Target End:1245 
miRNA Aligned Fragment:5'-UUGGACUGAAGGGAGCUCCU-3' 
Target Aligned Fragment:3'- AACCUGGUUUCCCACAAGGA -5' 
Inhibition Type:Cleavage 
MDP0000189746 
Target:MDP0000243495 
Target Start:1540 
Target End:1559 
miRNA Aligned Fragment:5'-UUGGACUGAAGGGAGCUCCU-3' 
Target Aligned Fragment:3'- GACCUGACUUCCCCAGGGGA -5' 
Inhibition Type:Cleavage 
MDP0000243495 
Data resource:
microPC
Wei et al.

All copyright are reserved by Prof. Huairui Shu 's lab at National Research Center for Apple Engineering and Technology,Shandong Agricultrural University

Web Site Designing & Administration Shizhong Zhang,Guanghui Chen and Yukun Liu ; IE 8 & 1600×900 Resolution Suggested