AppleGFDB:The Apple Gene Function & Gene Family DataBase v1.0
Locus Search:

 

miR319g

miR319g  

Mature Sequence:5'-TTGGACTGAAGGGAGCTCCCA-3'

Precursor Sequence:

_

Genome Location:Chr15:10904941..10904921
Precursor Coordinates:_
MFE:_
MFEI:_
GC:_
Plant Homologs:

_

Structure:
Target:MDP0000442611 
Target Start:840 
Target End:860 
miRNA Aligned Fragment:5'-UUGGACUGAAGGGAGCUCCCA-3' 
Target Aligned Fragment:3'- GACCUGACUUCCCAUGGGGGU -5' 
Inhibition Type:Cleavage 
MDP0000442611 
Target:MDP0000328318 
Target Start:987 
Target End:1007 
miRNA Aligned Fragment:5'-UUGGACUGAAGGGAGCUCCCA-3' 
Target Aligned Fragment:3'- GACCUGACUUCCCAUGGGGGU -5' 
Inhibition Type:Cleavage 
MDP0000328318 
Target:MDP0000205544 
Target Start:610 
Target End:629 
miRNA Aligned Fragment:5'-UUGGACUGAAGGGAGCUCCC-3' 
Target Aligned Fragment:3'- CACCUGAGUUCCCUCGAGGC -5' 
Inhibition Type:Cleavage 
MDP0000205544 
Target:MDP0000162193 
Target Start:1039 
Target End:1058 
miRNA Aligned Fragment:5'-UUGGACUGAAGGGAGCUCCC-3' 
Target Aligned Fragment:3'- AACCUGACUUACCUUGGAGG -5' 
Inhibition Type:Translation 
MDP0000162193 
Data resource:
microPC
Wei et al.

All copyright are reserved by Prof. Huairui Shu 's lab at National Research Center for Apple Engineering and Technology,Shandong Agricultrural University

Web Site Designing & Administration Shizhong Zhang,Guanghui Chen and Yukun Liu ; IE 8 & 1600×900 Resolution Suggested