AppleGFDB:The Apple Gene Function & Gene Family DataBase v1.0
Locus Search:

 

miR393a

miR393a  

Mature Sequence:5'-TCCAAAGGGATCGCATTGATCC-3'

Precursor Sequence:

ATTGCTTCTAGAGGAGGCATCCAAAGGGATCGCATTGATCCCAGCTAACTATTTATGTCC
ATCGCTTGGTTTGGATCATGCTATCCCTTTGGATTTCTCCTTTGGAAGCTTCAAACTTAT
TTCTATATATCTTGCATCAACGACTTCTTTCACGTTCAAGGTATTCAGCCAA

Genome Location:Chr1:28959393..28959414
Precursor Coordinates:181..353
MFE:-66.83
MFEI:0.95
GC:40.7
Plant Homologs:

aly-miR393a;aly-miR393b;ath-miR393a;ath-miR393b;zma-miR393b;

Structure:
Target:MDP0000249678 
Target Start:40 
Target End:60 
miRNA Aligned Fragment:5'-UCCAAAGGGAUCGCAUUGAUC-3' 
Target Aligned Fragment:3'- AGGUUUCCCUAGCGUAACUAG -5' 
Inhibition Type:Cleavage 
MDP0000249678 
Target:MDP0000469943 
Target Start:1120 
Target End:1141 
miRNA Aligned Fragment:5'-UCCAAAGGGAUCGCAUUGAUCC-3' 
Target Aligned Fragment:3'- AGGUUUCCCUAGCGUAACAAAG -5' 
Inhibition Type:Cleavage 
MDP0000469943 
Target:MDP0000268652 
Target Start:1501 
Target End:1522 
miRNA Aligned Fragment:5'-UCCAAAGGGAUCGCAUUGAUCC-3' 
Target Aligned Fragment:3'- AGGUUUCCCUAGCGUAACGAAG -5' 
Inhibition Type:Cleavage 
MDP0000268652 
Target:MDP0000203334 
Target Start:1858 
Target End:1879 
miRNA Aligned Fragment:5'-UCCAAAGGGAUCGCAUUGAUCC-3' 
Target Aligned Fragment:3'- AGGUUUCCCUAGCGUAACAAAG -5' 
Inhibition Type:Cleavage 
MDP0000203334 
Target:MDP0000498419 
Target Start:1524 
Target End:1543 
miRNA Aligned Fragment:5'-UCCAAAGGGAUCGCAUUGAU-3' 
Target Aligned Fragment:3'- AGGUUUCCCUAGCGUAACAG -5' 
Inhibition Type:Cleavage 
MDP0000498419 
Target:MDP0000125975 
Target Start:1506 
Target End:1525 
miRNA Aligned Fragment:5'-UCCAAAGGGAUCGCAUUGAU-3' 
Target Aligned Fragment:3'- AGGUUUCCCUAGCGUAACAG -5' 
Inhibition Type:Cleavage 
MDP0000125975 
Target:MDP0000213489 
Target Start:549 
Target End:569 
miRNA Aligned Fragment:5'-UCCAAAGGGAUCGCAUUGAUC-3' 
Target Aligned Fragment:3'- AGGUUUCUUUAGUGUAACGGG -5' 
Inhibition Type:Cleavage 
MDP0000213489 
Target:MDP0000258116 
Target Start:473 
Target End:492 
miRNA Aligned Fragment:5'-UCCAAAGGGAUCGCAUUGAU-3' 
Target Aligned Fragment:3'- GGGUUUCUUUGGUGUAGCUA -5' 
Inhibition Type:Cleavage 
MDP0000258116 
Target:MDP0000323014 
Target Start:19 
Target End:39 
miRNA Aligned Fragment:5'-UCCAAAGGGAUCGCAUUGAUCC-3' 
Target Aligned Fragment:3'- AGGUUUCCCUAUCGU-ACUAGG -5' 
Inhibition Type:Cleavage 
MDP0000323014 
Target:MDP0000191749 
Target Start:1428 
Target End:1448 
miRNA Aligned Fragment:5'-UCCAAAGGGAUCGCAUUGAUC-3' 
Target Aligned Fragment:3'- AGGUUUCCUUAGUAUAACGAG -5' 
Inhibition Type:Cleavage 
MDP0000191749 
Target:MDP0000934866 
Target Start:927 
Target End:946 
miRNA Aligned Fragment:5'-UCCAAAGGGAUCGCAUUGAU-3' 
Target Aligned Fragment:3'- AGUUUUCCCUGACGUAACUA -5' 
Inhibition Type:Cleavage 
MDP0000934866 
Target:MDP0000305861 
Target Start:3583 
Target End:3604 
miRNA Aligned Fragment:5'-UCCAAAGGGAUCGCAUUGAUCC-3' 
Target Aligned Fragment:3'- AGGUUUCACUAGAGUASCUAAG -5' 
Inhibition Type:Cleavage 
MDP0000305861 
Data resource:
Gleave, AP et al.
Huaping Yu et al.
microPC
microPC
mirNEST
Varkonyi Gasic et al.
Wei et al.

All copyright are reserved by Prof. Huairui Shu 's lab at National Research Center for Apple Engineering and Technology,Shandong Agricultrural University

Web Site Designing & Administration Shizhong Zhang,Guanghui Chen and Yukun Liu ; IE 8 & 1600×900 Resolution Suggested