AppleGFDB:The Apple Gene Function & Gene Family DataBase v1.0
Locus Search:

 

miR393b

miR393b  

Mature Sequence:5'-TCCAAAGGGATCGCATTGATCT-3'

Precursor Sequence:

AGTAGTGCAGGTGGAGGCTTCCAAAGGGATCGCATTGATCTAATTGATCAGATATGTCAA
ACATCATCCGCATAGACATATGGTGGGTTATGTTTTCGTCTGTGTAGTCGGATCATGCGA
TCCCTTCGGACGTTTCCATCGTCAGCTCTAAATCTCTAACTCATGTGATATA

Genome Location:Chr1:25544970..25544949
Precursor Coordinates:181..353
MFE:-69.4
MFEI:0.93
GC:43.6
Plant Homologs:

aly-miR393a;aly-miR393b;ath-miR393a;ath-miR393b;bna-miR393;ghr-miR393;vvi-miR393a;vvi-miR393b;csi-miR393;gma-miR393;mtr-miR393b;mtr-miR393;rco-miR393;zma-miR393c;zma-miR393b;zma-miR393a;osa-miR393b;osa-miR393;ptc-miR393c;ptc-miR393b;ptc-miR393d;ptc-miR393a;sbi-miR393;sbi-miR393b;

Structure:
Target:MDP0000249678 
Target Start:39 
Target End:60 
miRNA Aligned Fragment:5'-UCCAAAGGGAUCGCAUUGAUCU-3' 
Target Aligned Fragment:3'- AGGUUUCCCUAGCGUAACUAGA -5' 
Inhibition Type:Cleavage 
MDP0000249678 
Target:MDP0000469943 
Target Start:1122 
Target End:1141 
miRNA Aligned Fragment:5'-UCCAAAGGGAUCGCAUUGAU-3' 
Target Aligned Fragment:3'- AGGUUUCCCUAGCGUAACAA -5' 
Inhibition Type:Cleavage 
MDP0000469943 
Target:MDP0000268652 
Target Start:1503 
Target End:1522 
miRNA Aligned Fragment:5'-UCCAAAGGGAUCGCAUUGAU-3' 
Target Aligned Fragment:3'- AGGUUUCCCUAGCGUAACGA -5' 
Inhibition Type:Cleavage 
MDP0000268652 
Target:MDP0000203334 
Target Start:1860 
Target End:1879 
miRNA Aligned Fragment:5'-UCCAAAGGGAUCGCAUUGAU-3' 
Target Aligned Fragment:3'- AGGUUUCCCUAGCGUAACAA -5' 
Inhibition Type:Cleavage 
MDP0000203334 
Target:MDP0000498419 
Target Start:1524 
Target End:1543 
miRNA Aligned Fragment:5'-UCCAAAGGGAUCGCAUUGAU-3' 
Target Aligned Fragment:3'- AGGUUUCCCUAGCGUAACAG -5' 
Inhibition Type:Cleavage 
MDP0000498419 
Target:MDP0000125975 
Target Start:1506 
Target End:1525 
miRNA Aligned Fragment:5'-UCCAAAGGGAUCGCAUUGAU-3' 
Target Aligned Fragment:3'- AGGUUUCCCUAGCGUAACAG -5' 
Inhibition Type:Cleavage 
MDP0000125975 
Target:MDP0000191749 
Target Start:1427 
Target End:1448 
miRNA Aligned Fragment:5'-UCCAAAGGGAUCGCAUUGAUCU-3' 
Target Aligned Fragment:3'- AGGUUUCCUUAGUAUAACGAGA -5' 
Inhibition Type:Cleavage 
MDP0000191749 
Target:MDP0000213489 
Target Start:549 
Target End:569 
miRNA Aligned Fragment:5'-UCCAAAGGGAUCGCAUUGAUC-3' 
Target Aligned Fragment:3'- AGGUUUCUUUAGUGUAACGGG -5' 
Inhibition Type:Cleavage 
MDP0000213489 
Target:MDP0000258116 
Target Start:473 
Target End:492 
miRNA Aligned Fragment:5'-UCCAAAGGGAUCGCAUUGAU-3' 
Target Aligned Fragment:3'- GGGUUUCUUUGGUGUAGCUA -5' 
Inhibition Type:Cleavage 
MDP0000258116 
Target:MDP0000934866 
Target Start:925 
Target End:946 
miRNA Aligned Fragment:5'-UCCAAAGGGAUCGCAUUGAUCU-3' 
Target Aligned Fragment:3'- AGUUUUCCCUGACGUAACUAAA -5' 
Inhibition Type:Cleavage 
MDP0000934866 
Target:MDP0000323014 
Target Start:19 
Target End:39 
miRNA Aligned Fragment:5'-UCCAAAGGGAUCGCAUUGAUCU-3' 
Target Aligned Fragment:3'- AGGUUUCCCUAUCGU-ACUAGG -5' 
Inhibition Type:Cleavage 
MDP0000323014 
Data resource:
microPC
Wei et al.

All copyright are reserved by Prof. Huairui Shu 's lab at National Research Center for Apple Engineering and Technology,Shandong Agricultrural University

Web Site Designing & Administration Shizhong Zhang,Guanghui Chen and Yukun Liu ; IE 8 & 1600×900 Resolution Suggested