AppleGFDB:The Apple Gene Function & Gene Family DataBase v1.0
Locus Search:

 

miR393d

miR393d  

Mature Sequence:5'-TCCAAAGGGATCGCATTGATC-3'

Precursor Sequence:

TCCAAAGGGATCGCATTGATCCCAGCTAACTATTTATGTCCATCGCTTGGTTTGGATCAT
GCTATCCCTATGGA

Genome Location:UN
Precursor Coordinates:_
MFE:_
MFEI:_
GC:_
Plant Homologs:

_

Structure:
Target:MDP0000249678 
Target Start:40 
Target End:60 
miRNA Aligned Fragment:5'-UCCAAAGGGAUCGCAUUGAUC-3' 
Target Aligned Fragment:3'- AGGUUUCCCUAGCGUAACUAG -5' 
Inhibition Type:Cleavage 
MDP0000249678 
Target:MDP0000469943 
Target Start:1122 
Target End:1141 
miRNA Aligned Fragment:5'-UCCAAAGGGAUCGCAUUGAU-3' 
Target Aligned Fragment:3'- AGGUUUCCCUAGCGUAACAA -5' 
Inhibition Type:Cleavage 
MDP0000469943 
Target:MDP0000268652 
Target Start:1503 
Target End:1522 
miRNA Aligned Fragment:5'-UCCAAAGGGAUCGCAUUGAU-3' 
Target Aligned Fragment:3'- AGGUUUCCCUAGCGUAACGA -5' 
Inhibition Type:Cleavage 
MDP0000268652 
Target:MDP0000203334 
Target Start:1860 
Target End:1879 
miRNA Aligned Fragment:5'-UCCAAAGGGAUCGCAUUGAU-3' 
Target Aligned Fragment:3'- AGGUUUCCCUAGCGUAACAA -5' 
Inhibition Type:Cleavage 
MDP0000203334 
Target:MDP0000498419 
Target Start:1524 
Target End:1543 
miRNA Aligned Fragment:5'-UCCAAAGGGAUCGCAUUGAU-3' 
Target Aligned Fragment:3'- AGGUUUCCCUAGCGUAACAG -5' 
Inhibition Type:Cleavage 
MDP0000498419 
Target:MDP0000125975 
Target Start:1506 
Target End:1525 
miRNA Aligned Fragment:5'-UCCAAAGGGAUCGCAUUGAU-3' 
Target Aligned Fragment:3'- AGGUUUCCCUAGCGUAACAG -5' 
Inhibition Type:Cleavage 
MDP0000125975 
Target:MDP0000213489 
Target Start:549 
Target End:569 
miRNA Aligned Fragment:5'-UCCAAAGGGAUCGCAUUGAUC-3' 
Target Aligned Fragment:3'- AGGUUUCUUUAGUGUAACGGG -5' 
Inhibition Type:Cleavage 
MDP0000213489 
Target:MDP0000258116 
Target Start:473 
Target End:492 
miRNA Aligned Fragment:5'-UCCAAAGGGAUCGCAUUGAU-3' 
Target Aligned Fragment:3'- GGGUUUCUUUGGUGUAGCUA -5' 
Inhibition Type:Cleavage 
MDP0000258116 
Target:MDP0000191749 
Target Start:1428 
Target End:1448 
miRNA Aligned Fragment:5'-UCCAAAGGGAUCGCAUUGAUC-3' 
Target Aligned Fragment:3'- AGGUUUCCUUAGUAUAACGAG -5' 
Inhibition Type:Cleavage 
MDP0000191749 
Target:MDP0000934866 
Target Start:927 
Target End:946 
miRNA Aligned Fragment:5'-UCCAAAGGGAUCGCAUUGAU-3' 
Target Aligned Fragment:3'- AGUUUUCCCUGACGUAACUA -5' 
Inhibition Type:Cleavage 
MDP0000934866 
Target:MDP0000323014 
Target Start:20 
Target End:39 
miRNA Aligned Fragment:5'-UCCAAAGGGAUCGCAUUGAUC-3' 
Target Aligned Fragment:3'- AGGUUUCCCUAUCGU-ACUAG -5' 
Inhibition Type:Cleavage 
MDP0000323014 
Target:MDP0000305861 
Target Start:3585 
Target End:3604 
miRNA Aligned Fragment:5'-UCCAAAGGGAUCGCAUUGAU-3' 
Target Aligned Fragment:3'- AGGUUUCACUAGAGUASCUA -5' 
Inhibition Type:Cleavage 
MDP0000305861 
Data resource:
microPC

All copyright are reserved by Prof. Huairui Shu 's lab at National Research Center for Apple Engineering and Technology,Shandong Agricultrural University

Web Site Designing & Administration Shizhong Zhang,Guanghui Chen and Yukun Liu ; IE 8 & 1600×900 Resolution Suggested