AppleGFDB:The Apple Gene Function & Gene Family DataBase v1.0
Locus Search:

 

miR394a

miR394a  

Mature Sequence:5'-TTGGCATTCTGTCCACCTCC-3'

Precursor Sequence:

AAACTTGGATGATCACGTGGGTTTTGCAAAGAGTTTCTTACAGAGTTCTTTGGCATTCTG
TCCACCTCCCCCCTCTCTCTGTGTGTCTGTGGCTCAATGGATGGAGGTGGGCATACTGCC
AACAGAGCTCTGTTGGCTTCTCTTTGTAAAACCCCCGTGACGACATAGATGTATCTTTAC
GCAGTACTTCATCTTCCTCGTGACAATAGGGTAAGAATTC

Genome Location:Chr8:501290..501309
Precursor Coordinates:151..371
MFE:-88.7
MFEI:0.86
GC:46.82
Plant Homologs:

ahy-miR394;aly-miR394a;aly-miR394b;ath-miR394b;ath-miR394a;ghr-miR394a;ghr-miR394b;vvi-miR394b;vvi-miR394c;vvi-miR394a;csi-miR394;gma-miR394a;gma-miR394b;zma-miR394a;zma-miR394b*;zma-miR394a*;zma-miR394b;osa-miR394;ptc-miR394a-5p;ptc-miR394b-5p;sbi-miR394b;sbi-miR394a;

Structure:
Target:MDP0000278349 
Target Start:954 
Target End:973 
miRNA Aligned Fragment:5'-UUGGCAUUCUGUCCACCUCC-3' 
Target Aligned Fragment:3'- AGUCUUGAGACAGGUGGAGG -5' 
Inhibition Type:Cleavage 
MDP0000278349 
Target:MDP0000268873 
Target Start:1198 
Target End:1217 
miRNA Aligned Fragment:5'-UUGGCAUUCUGUCCACCUCC-3' 
Target Aligned Fragment:3'- CAUCGUGAGACAGGUGGAAG -5' 
Inhibition Type:Cleavage 
MDP0000268873 
Target:MDP0000209024 
Target Start:42 
Target End:61 
miRNA Aligned Fragment:5'-UUGGCAUUCUGUCCACCUCC-3' 
Target Aligned Fragment:3'- AAUCUUAAGACAGGAGGAGG -5' 
Inhibition Type:Cleavage 
MDP0000209024 
Target:MDP0000853426 
Target Start:84 
Target End:103 
miRNA Aligned Fragment:5'-UUGGCAUUCUGUCCACCUCC-3' 
Target Aligned Fragment:3'- AAUCUUAAGACAGGAGGAGG -5' 
Inhibition Type:Cleavage 
MDP0000853426 
Target:MDP0000278177 
Target Start:438 
Target End:457 
miRNA Aligned Fragment:5'-UUGGCAUUCUGUCCACCUCC-3' 
Target Aligned Fragment:3'- GGCCGUAAGGCGGGUGGAAG -5' 
Inhibition Type:Cleavage 
MDP0000278177 
Target:MDP0000275896 
Target Start:3 
Target End:22 
miRNA Aligned Fragment:5'-UUGGCAUUCUGUCCACCUCC-3' 
Target Aligned Fragment:3'- AACCGUAACGCAGGAGGAGG -5' 
Inhibition Type:Translation 
MDP0000275896 
Target:MDP0000290546 
Target Start:27 
Target End:47 
miRNA Aligned Fragment:5'-UUGGCAUUC-UGUCCACCUCC-3' 
Target Aligned Fragment:3'- AACCGUAAGAACAGGUGGACG -5' 
Inhibition Type:Translation 
MDP0000290546 
Data resource:
Huaping Yu et al.
Varkonyi Gasic et al.
Wei et al.

All copyright are reserved by Prof. Huairui Shu 's lab at National Research Center for Apple Engineering and Technology,Shandong Agricultrural University

Web Site Designing & Administration Shizhong Zhang,Guanghui Chen and Yukun Liu ; IE 8 & 1600×900 Resolution Suggested