AppleGFDB:The Apple Gene Function & Gene Family DataBase v1.0
Locus Search:

 

miR395b

miR395b  

Mature Sequence:5'-CTGAAGTGTTTGGGGGAACTC-3'

Precursor Sequence:

TACATCTGGAATCAGGTGTCCCCTAGAGTTCCCCCGAACACTTCATTAAGATCGATGCAT
AAGTTCTTTGTATATTAAATGATGATTGCACCATCTCTACTGAAGTGTTTGGGGGAACTC
CGGGTGTCATTTGATCATATCTCAACAAAACTGACTGGAGGTGATGGCTTG

Genome Location:Chr13:4893658..4893677
Precursor Coordinates:100..271
MFE:-67.4
MFEI:0.92
GC:42.69
Plant Homologs:

aly-miR395b;aly-miR395g;aly-miR395c;aly-miR395f;aly-miR395d*;aly-miR395h;aly-miR395d;aly-miR395i;aly-miR395e;ath-miR395a;ath-miR395f;ath-miR395d;ath-miR395c;ath-miR395b;ath-miR395e;sly-miR395b;sly-miR395a;tae-miR395b;tae-miR395a;vvi-miR395c;vvi-miR395j;vvi-miR395k;vvi-miR395e;vvi-miR395a;vvi-miR395h;vvi-miR395g;vvi-miR395l;vvi-miR395f;vvi-miR395i;vvi-miR395m;vvi-miR395b;vvi-miR395d;csi-miR395;mtr-miR395e;mtr-miR395i;mtr-miR395q;mtr-miR395m;mtr-miR395d;mtr-miR395l;mtr-miR395h;mtr-miR395p;mtr-miR395a;mtr-miR395k;mtr-miR395b;mtr-miR395j;mtr-miR395o;mtr-miR395r;mtr-miR395n;mtr-miR395f;mtr-miR395g;mtr-miR395c;pab-miR395;rco-miR395e;rco-miR395d;rco-miR395b;rco-miR395c;rco-miR395a;zma-miR395b;zma-miR395f;zma-miR395e;zma-miR395i;zma-miR395m;zma-miR395p;zma-miR395j;zma-miR395o;zma-miR395g;zma-miR395a;zma-miR395n;zma-miR395d;zma-miR395c;zma-miR395l;zma-miR395h;osa-miR395i;osa-miR395h;osa-miR395p;osa-miR395k;osa-miR395d;osa-miR395j;osa-miR395q;osa-miR395e;osa-miR395l;osa-miR395s;osa-miR395m;osa-miR395b;osa-miR395t;osa-miR395f;osa-miR395n;osa-miR395a;osa-miR395o;osa-miR395g;osa-miR395c;osa-miR395r;ptc-miR395c;ptc-miR395j;ptc-miR395e;ptc-miR395g;ptc-miR395d;ptc-miR395h;ptc-miR395i;ptc-miR395f;ptc-miR395b;sbi-miR395a;sbi-miR395i;sbi-miR395k;sbi-miR395c;sbi-miR395e;sbi-miR395g;sbi-miR395h;sbi-miR395j;sbi-miR395d;sbi-miR395l;sbi-miR395f;sbi-miR395b;

Structure:
Target:MDP0000121656 
Target Start:334 
Target End:353 
miRNA Aligned Fragment:5'-UGAAGUGUUUGGGGGAACUC-3' 
Target Aligned Fragment:3'- ACUUCUCAAACCUCCUUGAG -5' 
Inhibition Type:Cleavage 
MDP0000121656 
Target:MDP0000263161 
Target Start:1657 
Target End:1676 
miRNA Aligned Fragment:5'-UGAAGUGUUUGGGGGAACUC-3' 
Target Aligned Fragment:3'- ACUUCUCAAACCUCCUUGAG -5' 
Inhibition Type:Cleavage 
MDP0000263161 
Target:MDP0000293087 
Target Start:532 
Target End:551 
miRNA Aligned Fragment:5'-UGAAGUGUUUGGGGGAACUC-3' 
Target Aligned Fragment:3'- ACUUUAUAAACUUUCUUGAG -5' 
Inhibition Type:Cleavage 
MDP0000293087 
Target:MDP0000935996 
Target Start:314 
Target End:333 
miRNA Aligned Fragment:5'-UGAAGUGUUUGGGGGAACUC-3' 
Target Aligned Fragment:3'- ACUUCACAAAUCCUCUUGCC -5' 
Inhibition Type:Cleavage 
MDP0000935996 
Target:MDP0000266051 
Target Start:1047 
Target End:1066 
miRNA Aligned Fragment:5'-UGAAGUGUUUGGGGGAACUC-3' 
Target Aligned Fragment:3'- ACUUCACGAACCUUUUUGAU -5' 
Inhibition Type:Cleavage 
MDP0000266051 
Target:MDP0000301372 
Target Start:326 
Target End:345 
miRNA Aligned Fragment:5'-UGAAGUGUUUGGGGGAACUC-3' 
Target Aligned Fragment:3'- GCUUCACAACCCCCUUUGGG -5' 
Inhibition Type:Translation 
MDP0000301372 
Target:MDP0000862901 
Target Start:339 
Target End:358 
miRNA Aligned Fragment:5'-UGAAGUGUUUGGGGGAACUC-3' 
Target Aligned Fragment:3'- ACUUUACGAGUCUCUUUGAG -5' 
Inhibition Type:Cleavage 
MDP0000862901 
Target:MDP0000902543 
Target Start:535 
Target End:554 
miRNA Aligned Fragment:5'-UGAAGUGUUUGGGGGAACUC-3' 
Target Aligned Fragment:3'- ACUUUAUAGACUUUCUUGAG -5' 
Inhibition Type:Cleavage 
MDP0000902543 
Target:MDP0000718631 
Target Start:663 
Target End:682 
miRNA Aligned Fragment:5'-UGAAGUGUUUGGGGGAACUC-3' 
Target Aligned Fragment:3'- ACUUUACGAGUCUCUUUGAG -5' 
Inhibition Type:Cleavage 
MDP0000718631 
Target:MDP0000271544 
Target Start:266 
Target End:285 
miRNA Aligned Fragment:5'-UGAAGUGUUUGGGGGAACUC-3' 
Target Aligned Fragment:3'- AUUUUACGAACUUCUUUGAG -5' 
Inhibition Type:Cleavage 
MDP0000271544 
Target:MDP0000729657 
Target Start:1277 
Target End:1296 
miRNA Aligned Fragment:5'-UGAAGUGUUUGGGGGAACUC-3' 
Target Aligned Fragment:3'- GCUUCACAACCCCCUUUGGG -5' 
Inhibition Type:Translation 
MDP0000729657 
Target:MDP0000608985 
Target Start:924 
Target End:943 
miRNA Aligned Fragment:5'-UGAAGUGUUUGGGGGAACUC-3' 
Target Aligned Fragment:3'- ACUUUACGAGUCUCUUUGAG -5' 
Inhibition Type:Cleavage 
MDP0000608985 
Target:MDP0000333807 
Target Start:831 
Target End:850 
miRNA Aligned Fragment:5'-UGAAGUGUUUGGGGGAACUC-3' 
Target Aligned Fragment:3'- ACUUCGUAAACUCGUUUGAG -5' 
Inhibition Type:Cleavage 
MDP0000333807 
Target:MDP0000132186 
Target Start:116 
Target End:135 
miRNA Aligned Fragment:5'-UGAAGUGUUUGGGGGAACUC-3' 
Target Aligned Fragment:3'- ACUUCGCGCAUCUCCUUGAG -5' 
Inhibition Type:Translation 
MDP0000132186 
Target:MDP0000194500 
Target Start:31 
Target End:50 
miRNA Aligned Fragment:5'-UGAAGUGUUUGGGGGAACUC-3' 
Target Aligned Fragment:3'- ACUUUACGAACUCGUUUGAG -5' 
Inhibition Type:Cleavage 
MDP0000194500 
Data resource:
Wei et al.

All copyright are reserved by Prof. Huairui Shu 's lab at National Research Center for Apple Engineering and Technology,Shandong Agricultrural University

Web Site Designing & Administration Shizhong Zhang,Guanghui Chen and Yukun Liu ; IE 8 & 1600×900 Resolution Suggested