AppleGFDB:The Apple Gene Function & Gene Family DataBase v1.0
Locus Search:

 

miR396a

miR396a  

Mature Sequence:5'-TTCCACAGCTTTCTTGAACTG-3'

Precursor Sequence:

_

Genome Location:UN
Precursor Coordinates:_
MFE:_
MFEI:_
GC:_
Plant Homologs:

_

Structure:
Target:MDP0000233651 
Target Start:785 
Target End:804 
miRNA Aligned Fragment:5'-GUUCAAUAAAGCUGUGGGAA-3' 
Target Aligned Fragment:3'- UAAGUUGUUUCUGCGCCCUU -5' 
Inhibition Type:Cleavage 
MDP0000233651 
Target:MDP0000242241 
Target Start:842 
Target End:861 
miRNA Aligned Fragment:5'-GUUCAAUAAAGCUGUGGGAA-3' 
Target Aligned Fragment:3'- UAAGUUGUUUCUGCGCCCUU -5' 
Inhibition Type:Cleavage 
MDP0000242241 
Target:MDP0000513732 
Target Start:842 
Target End:861 
miRNA Aligned Fragment:5'-GUUCAAUAAAGCUGUGGGAA-3' 
Target Aligned Fragment:3'- UAAGUUGUUUCUGCGCCCUU -5' 
Inhibition Type:Cleavage 
MDP0000513732 
Target:MDP0000669809 
Target Start:725 
Target End:744 
miRNA Aligned Fragment:5'-GUUCAAUAAAGCUGUGGGAA-3' 
Target Aligned Fragment:3'- UAAGUUGUUUCUGCGCCCUU -5' 
Inhibition Type:Cleavage 
MDP0000669809 
Target:MDP0000501816 
Target Start:362 
Target End:381 
miRNA Aligned Fragment:5'-UUCCACAGCUUUCUUGAACU-3' 
Target Aligned Fragment:3'- AGGGUGUUGAAAGAACAUGA -5' 
Inhibition Type:Cleavage 
MDP0000501816 
Target:MDP0000193012 
Target Start:362 
Target End:381 
miRNA Aligned Fragment:5'-UUCCACAGCUUUCUUGAACU-3' 
Target Aligned Fragment:3'- AGGGUGUUGAAAGAACAUGA -5' 
Inhibition Type:Cleavage 
MDP0000193012 
Target:MDP0000160829 
Target Start:1288 
Target End:1308 
miRNA Aligned Fragment:5'-UUCCACAGCUUUCUUGAACUG-3' 
Target Aligned Fragment:3'- GAGGUGUCGAAAAAACUUCAC -5' 
Inhibition Type:Cleavage 
MDP0000160829 
Target:MDP0000553830 
Target Start:1285 
Target End:1305 
miRNA Aligned Fragment:5'-UUCCACAGCUUUCUUGAACUG-3' 
Target Aligned Fragment:3'- GAGGUGUCGAAAAAACUUCAC -5' 
Inhibition Type:Cleavage 
MDP0000553830 
Target:MDP0000677637 
Target Start:2234 
Target End:2253 
miRNA Aligned Fragment:5'-UUCCACAGCUUUCUUGAACU-3' 
Target Aligned Fragment:3'- CAGGUGUCGAAAUGACUUGA -5' 
Inhibition Type:Cleavage 
MDP0000677637 
Target:MDP0000613111 
Target Start:406 
Target End:426 
miRNA Aligned Fragment:5'-UUCCACAGCUUUCUUGAACUG-3' 
Target Aligned Fragment:3'- AAGGUGUCGAAGGAGUAUGGU -5' 
Inhibition Type:Cleavage 
MDP0000613111 
Target:MDP0000204043 
Target Start:1540 
Target End:1560 
miRNA Aligned Fragment:5'-UUCCACAGCUUUCUUGAACUG-3' 
Target Aligned Fragment:3'- AAGGUGUCGAACAAGUUUGAC -5' 
Inhibition Type:Cleavage 
MDP0000204043 
Target:MDP0000309706 
Target Start:300 
Target End:320 
miRNA Aligned Fragment:5'-UUCCACAGCUUUCUUGAACUG-3' 
Target Aligned Fragment:3'- AAGGUGUCGAAGGAGUAUGGU -5' 
Inhibition Type:Cleavage 
MDP0000309706 
Target:MDP0000261112 
Target Start:312 
Target End:333 
miRNA Aligned Fragment:5'-UUCCACA-GCUUUCUUGAACUG-3' 
Target Aligned Fragment:3'- AAGGUGUCCGAAAGAACUUGCC -5' 
Inhibition Type:Cleavage 
MDP0000261112 
Target:MDP0000243533 
Target Start:348 
Target End:369 
miRNA Aligned Fragment:5'-UUCCACA-GCUUUCUUGAACUG-3' 
Target Aligned Fragment:3'- AAGGUGUCCGAAAGAACUUGCC -5' 
Inhibition Type:Cleavage 
MDP0000243533 
Target:MDP0000808163 
Target Start:546 
Target End:567 
miRNA Aligned Fragment:5'-UUCCACA-GCUUUCUUGAACUG-3' 
Target Aligned Fragment:3'- AAGGUGUCCGAAAGAACUUGCC -5' 
Inhibition Type:Cleavage 
MDP0000808163 
Target:MDP0000274400 
Target Start:351 
Target End:372 
miRNA Aligned Fragment:5'-UUCCACA-GCUUUCUUGAACUG-3' 
Target Aligned Fragment:3'- AAGGUGUCCGAAAGAACUUGCC -5' 
Inhibition Type:Cleavage 
MDP0000274400 
Data resource:
Varkonyi Gasic et al.
Wei et al.

All copyright are reserved by Prof. Huairui Shu 's lab at National Research Center for Apple Engineering and Technology,Shandong Agricultrural University

Web Site Designing & Administration Shizhong Zhang,Guanghui Chen and Yukun Liu ; IE 8 & 1600×900 Resolution Suggested