AppleGFDB:The Apple Gene Function & Gene Family DataBase v1.0
Locus Search:

 

miR396a*

miR396a*  

Mature Sequence:5'-GTTCAATAAAGCTGTGGGAAG-3'

Precursor Sequence:

CTTCCACAGCTTTCTTGAACAGCATCCATGTATGACGAGATCGACCGATCTTTGGAGTGA
GTCGACTCAGTCTCTCTATTCCTCTTAACTTGGTTTGCGGTTCAATAAAGCTGTGGGAAG
ATACAGATAGGCTCAATAAATTCACTCACATATCGGATCTCCATTGTCCCT

Genome Location:Chr15:9671331..9671351
Precursor Coordinates:199..370
MFE:-52.5
MFEI:0.7
GC:43.86
Plant Homologs:

aly-miR396b*;aly-miR396a*;zma-miR396f*;zma-miR396a*;zma-miR396b*;

Structure:
Target:MDP0000233651 
Target Start:785 
Target End:804 
miRNA Aligned Fragment:5'-GUUCAAUAAAGCUGUGGGAA-3' 
Target Aligned Fragment:3'- UAAGUUGUUUCUGCGCCCUU -5' 
Inhibition Type:Cleavage 
MDP0000233651 
Target:MDP0000242241 
Target Start:842 
Target End:861 
miRNA Aligned Fragment:5'-GUUCAAUAAAGCUGUGGGAA-3' 
Target Aligned Fragment:3'- UAAGUUGUUUCUGCGCCCUU -5' 
Inhibition Type:Cleavage 
MDP0000242241 
Target:MDP0000513732 
Target Start:842 
Target End:861 
miRNA Aligned Fragment:5'-GUUCAAUAAAGCUGUGGGAA-3' 
Target Aligned Fragment:3'- UAAGUUGUUUCUGCGCCCUU -5' 
Inhibition Type:Cleavage 
MDP0000513732 
Target:MDP0000669809 
Target Start:725 
Target End:744 
miRNA Aligned Fragment:5'-GUUCAAUAAAGCUGUGGGAA-3' 
Target Aligned Fragment:3'- UAAGUUGUUUCUGCGCCCUU -5' 
Inhibition Type:Cleavage 
MDP0000669809 
Data resource:
Wei et al.

All copyright are reserved by Prof. Huairui Shu 's lab at National Research Center for Apple Engineering and Technology,Shandong Agricultrural University

Web Site Designing & Administration Shizhong Zhang,Guanghui Chen and Yukun Liu ; IE 8 & 1600×900 Resolution Suggested