AppleGFDB:The Apple Gene Function & Gene Family DataBase v1.0
Locus Search:

 

miR396b

miR396b  

Mature Sequence:5'-TTCCACAGCTTTCTTGAACTT-3'

Precursor Sequence:

ACAAGTCCTTGCCATGCTTTTCCACAGCTTTCTTGAACTTCAATTCTCTGCTGTCTAAAT
MTCTTTCAGGACTAGCACCATGGAAGCTCAAGAAAGCTGTGGGAGACCATGGCAATTCTG
GACTTAACCATTTCAATYTCCCTACAACGTTCGCTGCAGACAAAATGAAAA

Genome Location:Chr15:9680151..9680131
Precursor Coordinates:181..352
MFE:-64.2
MFEI:0.89
GC:42.11
Plant Homologs:

aly-miR396b;aly-miR396b*;aly-miR396a;aly-miR396a*;ath-miR396b;ath-miR396a;bna-miR396a;ccl-miR396;ghr-miR396b;ghr-miR396a;vvi-miR396a;vvi-miR396d;vvi-miR396b;vvi-miR396c;aqc-miR396b;aqc-miR396a;csi-miR396b;csi-miR396a;gma-miR396b;gma-miR396c;gma-miR396a;gma-miR396e;gma-miR396d;mtr-miR396a;mtr-miR396b;pab-miR396b;pab-miR396a;pab-miR396c;pta-miR396;rco-miR396;zma-miR396g*;zma-miR396b;zma-miR396a;zma-miR396f*;zma-miR396a*;zma-miR396e;zma-miR396f;zma-miR396b*;lja-miR396;osa-miR396c;osa-miR396b;osa-miR396a;ptc-miR396b;ptc-miR396d;ptc-miR396c;ptc-miR396a;ptc-miR396e;ptc-miR396g;sbi-miR396c;sbi-miR396b;sbi-miR396a;sof-miR396;

Structure:
Target:MDP0000677637 
Target Start:2233 
Target End:2253 
miRNA Aligned Fragment:5'-UUCCACAGCUUUCUUGAACUU-3' 
Target Aligned Fragment:3'- CAGGUGUCGAAAUGACUUGAA -5' 
Inhibition Type:Cleavage 
MDP0000677637 
Target:MDP0000193012 
Target Start:361 
Target End:381 
miRNA Aligned Fragment:5'-UUCCACAGCUUUCUUGAACUU-3' 
Target Aligned Fragment:3'- AGGGUGUUGAAAGAACAUGAG -5' 
Inhibition Type:Cleavage 
MDP0000193012 
Target:MDP0000501816 
Target Start:361 
Target End:381 
miRNA Aligned Fragment:5'-UUCCACAGCUUUCUUGAACUU-3' 
Target Aligned Fragment:3'- AGGGUGUUGAAAGAACAUGAG -5' 
Inhibition Type:Cleavage 
MDP0000501816 
Target:MDP0000179031 
Target Start:472 
Target End:492 
miRNA Aligned Fragment:5'-UUCCACAGCUUUCUUGAACUU-3' 
Target Aligned Fragment:3'- GAGGUGUUGAGGGAACUGGAG -5' 
Inhibition Type:Cleavage 
MDP0000179031 
Target:MDP0000603111 
Target Start:475 
Target End:495 
miRNA Aligned Fragment:5'-UUCCACAGCUUUCUUGAACUU-3' 
Target Aligned Fragment:3'- AAGGUGUCGAAGGCCCUUGAG -5' 
Inhibition Type:Cleavage 
MDP0000603111 
Target:MDP0000314475 
Target Start:559 
Target End:579 
miRNA Aligned Fragment:5'-UUCCACAGCUUUCUUGAACUU-3' 
Target Aligned Fragment:3'- AAGGUGUCGAAGGCCCUUGAG -5' 
Inhibition Type:Cleavage 
MDP0000314475 
Target:MDP0000297552 
Target Start:1087 
Target End:1107 
miRNA Aligned Fragment:5'-UUCCACAGCUUUCUUGAACUU-3' 
Target Aligned Fragment:3'- ACGGUGUCGAAAGAAUAUGAG -5' 
Inhibition Type:Cleavage 
MDP0000297552 
Target:MDP0000193012 
Target Start:362 
Target End:381 
miRNA Aligned Fragment:5'-UUCCACAGCUUUCUUGAACU-3' 
Target Aligned Fragment:3'- AGGGUGUUGAAAGAACAUGA -5' 
Inhibition Type:Cleavage 
MDP0000193012 
Target:MDP0000501816 
Target Start:362 
Target End:381 
miRNA Aligned Fragment:5'-UUCCACAGCUUUCUUGAACU-3' 
Target Aligned Fragment:3'- AGGGUGUUGAAAGAACAUGA -5' 
Inhibition Type:Cleavage 
MDP0000501816 
Target:MDP0000677637 
Target Start:2234 
Target End:2253 
miRNA Aligned Fragment:5'-UUCCACAGCUUUCUUGAACU-3' 
Target Aligned Fragment:3'- CAGGUGUCGAAAUGACUUGA -5' 
Inhibition Type:Cleavage 
MDP0000677637 
Target:MDP0000179031 
Target Start:473 
Target End:492 
miRNA Aligned Fragment:5'-UUCCACAGCUUUCUUGAACU-3' 
Target Aligned Fragment:3'- GAGGUGUUGAGGGAACUGGA -5' 
Inhibition Type:Cleavage 
MDP0000179031 
Target:MDP0000603111 
Target Start:476 
Target End:495 
miRNA Aligned Fragment:5'-UUCCACAGCUUUCUUGAACU-3' 
Target Aligned Fragment:3'- AAGGUGUCGAAGGCCCUUGA -5' 
Inhibition Type:Cleavage 
MDP0000603111 
Target:MDP0000314475 
Target Start:560 
Target End:579 
miRNA Aligned Fragment:5'-UUCCACAGCUUUCUUGAACU-3' 
Target Aligned Fragment:3'- AAGGUGUCGAAGGCCCUUGA -5' 
Inhibition Type:Cleavage 
MDP0000314475 
Target:MDP0000261112 
Target Start:314 
Target End:333 
miRNA Aligned Fragment:5'-UUCCACA-GCUUUCUUGAAC-3' 
Target Aligned Fragment:3'- AAGGUGUCCGAAAGAACUUG -5' 
Inhibition Type:Cleavage 
MDP0000261112 
Target:MDP0000243533 
Target Start:350 
Target End:369 
miRNA Aligned Fragment:5'-UUCCACA-GCUUUCUUGAAC-3' 
Target Aligned Fragment:3'- AAGGUGUCCGAAAGAACUUG -5' 
Inhibition Type:Cleavage 
MDP0000243533 
Target:MDP0000808163 
Target Start:548 
Target End:567 
miRNA Aligned Fragment:5'-UUCCACA-GCUUUCUUGAAC-3' 
Target Aligned Fragment:3'- AAGGUGUCCGAAAGAACUUG -5' 
Inhibition Type:Cleavage 
MDP0000808163 
Target:MDP0000297552 
Target Start:1088 
Target End:1107 
miRNA Aligned Fragment:5'-UUCCACAGCUUUCUUGAACU-3' 
Target Aligned Fragment:3'- ACGGUGUCGAAAGAAUAUGA -5' 
Inhibition Type:Cleavage 
MDP0000297552 
Target:MDP0000274400 
Target Start:353 
Target End:372 
miRNA Aligned Fragment:5'-UUCCACA-GCUUUCUUGAAC-3' 
Target Aligned Fragment:3'- AAGGUGUCCGAAAGAACUUG -5' 
Inhibition Type:Cleavage 
MDP0000274400 
Target:MDP0000276970 
Target Start:374 
Target End:393 
miRNA Aligned Fragment:5'-UUCCAC-AGCUUUCUUGAAC-3' 
Target Aligned Fragment:3'- AAGGUGUUCGAAAGAACUUG -5' 
Inhibition Type:Cleavage 
MDP0000276970 
Target:MDP0000322576 
Target Start:602 
Target End:621 
miRNA Aligned Fragment:5'-UUCCACA-GCUUUCUUGAAC-3' 
Target Aligned Fragment:3'- AAGGUGUCCGAAAGAACUUG -5' 
Inhibition Type:Cleavage 
MDP0000322576 
Target:MDP0000160829 
Target Start:1289 
Target End:1308 
miRNA Aligned Fragment:5'-UUCCACAGCUUUCUUGAACU-3' 
Target Aligned Fragment:3'- GAGGUGUCGAAAAAACUUCA -5' 
Inhibition Type:Cleavage 
MDP0000160829 
Data resource:
Wei et al.

All copyright are reserved by Prof. Huairui Shu 's lab at National Research Center for Apple Engineering and Technology,Shandong Agricultrural University

Web Site Designing & Administration Shizhong Zhang,Guanghui Chen and Yukun Liu ; IE 8 & 1600×900 Resolution Suggested