AppleGFDB:The Apple Gene Function & Gene Family DataBase v1.0
Locus Search:

 

miR396f

miR396f  

Mature Sequence:5'-TTCCACGGCTTTCTTGAACTG-3'

Precursor Sequence:

GATGATCCTCCTTGYGATTTTCCACGGCTTTCTTGAACTGTGCAGTGTGCAGAAGAGTTA
AACTGGCAGAAATTTTTCATGCAGTTACATAAACAGTTCAAGAAAGCTGTGAAAAACCAC
AGGCAGGATTTGAATTGTTCATAAAAAAGATTCTGATCGTCTCCTTCAAAC

Genome Location:Chr8:19138342..19138362
Precursor Coordinates:181..352
MFE:-55.5
MFEI:-55.5
GC:38.6
Plant Homologs:

pab-miR396b;pab-miR396c;smo-miR396;zma-miR396g*;ptc-miR396f;ptc-miR396g;

Structure:
Target:MDP0000501816 
Target Start:362 
Target End:381 
miRNA Aligned Fragment:5'-UUCCACGGCUUUCUUGAACU-3' 
Target Aligned Fragment:3'- AGGGUGUUGAAAGAACAUGA -5' 
Inhibition Type:Cleavage 
MDP0000501816 
Target:MDP0000193012 
Target Start:362 
Target End:381 
miRNA Aligned Fragment:5'-UUCCACGGCUUUCUUGAACU-3' 
Target Aligned Fragment:3'- AGGGUGUUGAAAGAACAUGA -5' 
Inhibition Type:Cleavage 
MDP0000193012 
Target:MDP0000160829 
Target Start:1288 
Target End:1308 
miRNA Aligned Fragment:5'-UUCCACGGCUUUCUUGAACUG-3' 
Target Aligned Fragment:3'- GAGGUGUCGAAAAAACUUCAC -5' 
Inhibition Type:Cleavage 
MDP0000160829 
Target:MDP0000553830 
Target Start:1285 
Target End:1305 
miRNA Aligned Fragment:5'-UUCCACGGCUUUCUUGAACUG-3' 
Target Aligned Fragment:3'- GAGGUGUCGAAAAAACUUCAC -5' 
Inhibition Type:Cleavage 
MDP0000553830 
Target:MDP0000279176 
Target Start:2743 
Target End:2763 
miRNA Aligned Fragment:5'-UUCCACGGCUUUCUUGAACUG-3' 
Target Aligned Fragment:3'- GAGGUGCGGAAAGGAGUUGAC -5' 
Inhibition Type:Cleavage 
MDP0000279176 
Target:MDP0000261112 
Target Start:312 
Target End:333 
miRNA Aligned Fragment:5'-UUCCAC-GGCUUUCUUGAACUG-3' 
Target Aligned Fragment:3'- AAGGUGUCCGAAAGAACUUGCC -5' 
Inhibition Type:Cleavage 
MDP0000261112 
Target:MDP0000243533 
Target Start:348 
Target End:369 
miRNA Aligned Fragment:5'-UUCCAC-GGCUUUCUUGAACUG-3' 
Target Aligned Fragment:3'- AAGGUGUCCGAAAGAACUUGCC -5' 
Inhibition Type:Cleavage 
MDP0000243533 
Target:MDP0000808163 
Target Start:546 
Target End:567 
miRNA Aligned Fragment:5'-UUCCAC-GGCUUUCUUGAACUG-3' 
Target Aligned Fragment:3'- AAGGUGUCCGAAAGAACUUGCC -5' 
Inhibition Type:Cleavage 
MDP0000808163 
Target:MDP0000274400 
Target Start:351 
Target End:372 
miRNA Aligned Fragment:5'-UUCCAC-GGCUUUCUUGAACUG-3' 
Target Aligned Fragment:3'- AAGGUGUCCGAAAGAACUUGCC -5' 
Inhibition Type:Cleavage 
MDP0000274400 
Target:MDP0000322576 
Target Start:600 
Target End:621 
miRNA Aligned Fragment:5'-UUCCAC-GGCUUUCUUGAACUG-3' 
Target Aligned Fragment:3'- AAGGUGUCCGAAAGAACUUGCC -5' 
Inhibition Type:Cleavage 
MDP0000322576 
Target:MDP0000677637 
Target Start:2234 
Target End:2253 
miRNA Aligned Fragment:5'-UUCCACGGCUUUCUUGAACU-3' 
Target Aligned Fragment:3'- CAGGUGUCGAAAUGACUUGA -5' 
Inhibition Type:Cleavage 
MDP0000677637 
Target:MDP0000125282 
Target Start:776 
Target End:795 
miRNA Aligned Fragment:5'-UUCCAC-GGCUUUCUUGAAC-3' 
Target Aligned Fragment:3'- AAGGUGUCCGAAAGAACUUG -5' 
Inhibition Type:Cleavage 
MDP0000125282 
Target:MDP0000215583 
Target Start:755 
Target End:774 
miRNA Aligned Fragment:5'-UUCCAC-GGCUUUCUUGAAC-3' 
Target Aligned Fragment:3'- AAGGUGUCCGAAAGAACUUG -5' 
Inhibition Type:Cleavage 
MDP0000215583 
Target:MDP0000320460 
Target Start:572 
Target End:591 
miRNA Aligned Fragment:5'-UUCCACGGCUUUCUUGAACU-3' 
Target Aligned Fragment:3'- AAGGUGCUYGAAGAACUCGA -5' 
Inhibition Type:Translation 
MDP0000320460 
Target:MDP0000127332 
Target Start:3086 
Target End:3105 
miRNA Aligned Fragment:5'-UUCCACGGCUUUCUUGAACU-3' 
Target Aligned Fragment:3'- GGGGUGCCGAAAGAGUUCGA -5' 
Inhibition Type:Cleavage 
MDP0000127332 
Target:MDP0000212849 
Target Start:3086 
Target End:3105 
miRNA Aligned Fragment:5'-UUCCACGGCUUUCUUGAACU-3' 
Target Aligned Fragment:3'- GGGGUGCCGAAAGAGUUCGA -5' 
Inhibition Type:Cleavage 
MDP0000212849 
Data resource:
Wei et al.

All copyright are reserved by Prof. Huairui Shu 's lab at National Research Center for Apple Engineering and Technology,Shandong Agricultrural University

Web Site Designing & Administration Shizhong Zhang,Guanghui Chen and Yukun Liu ; IE 8 & 1600×900 Resolution Suggested