AppleGFDB:The Apple Gene Function & Gene Family DataBase v1.0
Locus Search:

 

miR396g

miR396g  

Mature Sequence:5'-TCCACAGGCTTTCTTGAACGG-3'

Precursor Sequence:

_

Genome Location:Chr6:15873703..15873683
Precursor Coordinates:_
MFE:_
MFEI:_
GC:_
Plant Homologs:

_

Structure:
Target:MDP0000261112 
Target Start:312 
Target End:332 
miRNA Aligned Fragment:5'-UCCACAGGCUUUCUUGAACGG-3' 
Target Aligned Fragment:3'- AGGUGUCCGAAAGAACUUGCC -5' 
Inhibition Type:Cleavage 
MDP0000261112 
Target:MDP0000243533 
Target Start:348 
Target End:368 
miRNA Aligned Fragment:5'-UCCACAGGCUUUCUUGAACGG-3' 
Target Aligned Fragment:3'- AGGUGUCCGAAAGAACUUGCC -5' 
Inhibition Type:Cleavage 
MDP0000243533 
Target:MDP0000808163 
Target Start:546 
Target End:566 
miRNA Aligned Fragment:5'-UCCACAGGCUUUCUUGAACGG-3' 
Target Aligned Fragment:3'- AGGUGUCCGAAAGAACUUGCC -5' 
Inhibition Type:Cleavage 
MDP0000808163 
Target:MDP0000274400 
Target Start:351 
Target End:371 
miRNA Aligned Fragment:5'-UCCACAGGCUUUCUUGAACGG-3' 
Target Aligned Fragment:3'- AGGUGUCCGAAAGAACUUGCC -5' 
Inhibition Type:Cleavage 
MDP0000274400 
Target:MDP0000322576 
Target Start:600 
Target End:620 
miRNA Aligned Fragment:5'-UCCACAGGCUUUCUUGAACGG-3' 
Target Aligned Fragment:3'- AGGUGUCCGAAAGAACUUGCC -5' 
Inhibition Type:Cleavage 
MDP0000322576 
Target:MDP0000842815 
Target Start:654 
Target End:674 
miRNA Aligned Fragment:5'-UCCACAGGCUUUCUUGAACGG-3' 
Target Aligned Fragment:3'- AGGUGUCCGAAAGAACUUGCC -5' 
Inhibition Type:Cleavage 
MDP0000842815 
Target:MDP0000214734 
Target Start:558 
Target End:578 
miRNA Aligned Fragment:5'-UCCACAGGCUUUCUUGAACGG-3' 
Target Aligned Fragment:3'- AGGYGUCCGAAAGAACUUGCC -5' 
Inhibition Type:Cleavage 
MDP0000214734 
Target:MDP0000125282 
Target Start:774 
Target End:794 
miRNA Aligned Fragment:5'-UCCACAGGCUUUCUUGAACGG-3' 
Target Aligned Fragment:3'- AGGUGUCCGAAAGAACUUGCU -5' 
Inhibition Type:Cleavage 
MDP0000125282 
Target:MDP0000215583 
Target Start:753 
Target End:773 
miRNA Aligned Fragment:5'-UCCACAGGCUUUCUUGAACGG-3' 
Target Aligned Fragment:3'- AGGUGUCCGAAAGAACUUGCU -5' 
Inhibition Type:Cleavage 
MDP0000215583 
Target:MDP0000276970 
Target Start:372 
Target End:392 
miRNA Aligned Fragment:5'-UCCACAGGCUUUCUUGAACGG-3' 
Target Aligned Fragment:3'- AGGUGUUCGAAAGAACUUGCU -5' 
Inhibition Type:Cleavage 
MDP0000276970 
Target:MDP0000814056 
Target Start:630 
Target End:650 
miRNA Aligned Fragment:5'-UCCACAGGCUUUCUUGAACGG-3' 
Target Aligned Fragment:3'- AGGUGUACGAAAGAACUUGCC -5' 
Inhibition Type:Cleavage 
MDP0000814056 
Target:MDP0000204597 
Target Start:487 
Target End:506 
miRNA Aligned Fragment:5'-UCCACAGGCUUUCUUGAACG-3' 
Target Aligned Fragment:3'- AGGUGUACGAAAGAACUUGC -5' 
Inhibition Type:Cleavage 
MDP0000204597 
Target:MDP0000292682 
Target Start:959 
Target End:978 
miRNA Aligned Fragment:5'-UCCACAGGCUUUCUUGAACG-3' 
Target Aligned Fragment:3'- AGGUGUUCGAAGGAGUUUGC -5' 
Inhibition Type:Cleavage 
MDP0000292682 
Target:MDP0000184906 
Target Start:1204 
Target End:1223 
miRNA Aligned Fragment:5'-UCCACAGGCUUUCUUGAACG-3' 
Target Aligned Fragment:3'- GGGUGUUUGAAAGAACUUGG -5' 
Inhibition Type:Cleavage 
MDP0000184906 
Target:MDP0000416307 
Target Start:121 
Target End:141 
miRNA Aligned Fragment:5'-UCCACAGGCUUUCUUGAACGG-3' 
Target Aligned Fragment:3'- AGGUGUCCGGAACAACUUACC -5' 
Inhibition Type:Cleavage 
MDP0000416307 
Target:MDP0000200945 
Target Start:754 
Target End:774 
miRNA Aligned Fragment:5'-GUUCAAGAAAGCUGUGGAAGA-3' 
Target Aligned Fragment:3'- CGAGUUCUUUGGACACCUUUU -5' 
Inhibition Type:Translation 
MDP0000200945 
Target:MDP0000296652 
Target Start:754 
Target End:774 
miRNA Aligned Fragment:5'-GUUCAAGAAAGCUGUGGAAGA-3' 
Target Aligned Fragment:3'- CGAGUUCUUUGGACACCUUUU -5' 
Inhibition Type:Translation 
MDP0000296652 
Target:MDP0000039464 
Target Start:612 
Target End:632 
miRNA Aligned Fragment:5'-GUUCAAGAAAGCUGUGGAAGA-3' 
Target Aligned Fragment:3'- CCGGUUCUUUCGGCACUUUCU -5' 
Inhibition Type:Cleavage 
MDP0000039464 
Target:MDP0000218957 
Target Start:439 
Target End:459 
miRNA Aligned Fragment:5'-GUUCAAGAAAGCUGUGGAAGA-3' 
Target Aligned Fragment:3'- UAGGUUCUUUCAAURCCUUCU -5' 
Inhibition Type:Cleavage 
MDP0000218957 
Target:MDP0000839822 
Target Start:12 
Target End:31 
miRNA Aligned Fragment:5'-GUUCAAGAAAGCUGUGGAAG-3' 
Target Aligned Fragment:3'- AAAGUUUUUUUGACAACUUC -5' 
Inhibition Type:Cleavage 
MDP0000839822 
Target:MDP0000227161 
Target Start:26 
Target End:45 
miRNA Aligned Fragment:5'-GUUCAAGAAAGCUGUGGAAG-3' 
Target Aligned Fragment:3'- CGAGCUCUUUAGACACCUUC -5' 
Inhibition Type:Translation 
MDP0000227161 
Target:MDP0000275389 
Target Start:27 
Target End:46 
miRNA Aligned Fragment:5'-GUUCAAGAAAGCUGUGGAAG-3' 
Target Aligned Fragment:3'- CGAGCUCUUUAGACACCUUC -5' 
Inhibition Type:Translation 
MDP0000275389 
Data resource:
Wei et al.
Wei et al.

All copyright are reserved by Prof. Huairui Shu 's lab at National Research Center for Apple Engineering and Technology,Shandong Agricultrural University

Web Site Designing & Administration Shizhong Zhang,Guanghui Chen and Yukun Liu ; IE 8 & 1600×900 Resolution Suggested