AppleGFDB:The Apple Gene Function & Gene Family DataBase v1.0
Locus Search:

 

miR396g*

miR396g*  

Mature Sequence:5'-GTTCAAGAAAGCTGTGGAAGA-3'

Precursor Sequence:

TATTGAGCCTATCTGTATCTTCCCACAGCTTTATTGAACCGCAAACCAAGTTAAGAGGAA
TAGAGAGACTGAGTCGACTCACTCCAAAGATCGGTCGATCTCGTCATACATGGATGCTGT
TCAAGAAAGCTGTGGAAGAATACAAAGAGGATCATCATCTTCTATCTATTA

Genome Location:Chr15:9671251..9671231
Precursor Coordinates:82..253
MFE:-56.02
MFEI:0.8
GC:40.94
Plant Homologs:

zma-miR396h;zma-miR396g;zma-miR396g*;

Structure:
Target:MDP0000200945 
Target Start:754 
Target End:774 
miRNA Aligned Fragment:5'-GUUCAAGAAAGCUGUGGAAGA-3' 
Target Aligned Fragment:3'- CGAGUUCUUUGGACACCUUUU -5' 
Inhibition Type:Translation 
MDP0000200945 
Target:MDP0000296652 
Target Start:754 
Target End:774 
miRNA Aligned Fragment:5'-GUUCAAGAAAGCUGUGGAAGA-3' 
Target Aligned Fragment:3'- CGAGUUCUUUGGACACCUUUU -5' 
Inhibition Type:Translation 
MDP0000296652 
Target:MDP0000039464 
Target Start:612 
Target End:632 
miRNA Aligned Fragment:5'-GUUCAAGAAAGCUGUGGAAGA-3' 
Target Aligned Fragment:3'- CCGGUUCUUUCGGCACUUUCU -5' 
Inhibition Type:Cleavage 
MDP0000039464 
Target:MDP0000218957 
Target Start:439 
Target End:459 
miRNA Aligned Fragment:5'-GUUCAAGAAAGCUGUGGAAGA-3' 
Target Aligned Fragment:3'- UAGGUUCUUUCAAURCCUUCU -5' 
Inhibition Type:Cleavage 
MDP0000218957 
Target:MDP0000839822 
Target Start:12 
Target End:31 
miRNA Aligned Fragment:5'-GUUCAAGAAAGCUGUGGAAG-3' 
Target Aligned Fragment:3'- AAAGUUUUUUUGACAACUUC -5' 
Inhibition Type:Cleavage 
MDP0000839822 
Target:MDP0000227161 
Target Start:26 
Target End:45 
miRNA Aligned Fragment:5'-GUUCAAGAAAGCUGUGGAAG-3' 
Target Aligned Fragment:3'- CGAGCUCUUUAGACACCUUC -5' 
Inhibition Type:Translation 
MDP0000227161 
Target:MDP0000275389 
Target Start:27 
Target End:46 
miRNA Aligned Fragment:5'-GUUCAAGAAAGCUGUGGAAG-3' 
Target Aligned Fragment:3'- CGAGCUCUUUAGACACCUUC -5' 
Inhibition Type:Translation 
MDP0000275389 
Data resource:
Wei et al.

All copyright are reserved by Prof. Huairui Shu 's lab at National Research Center for Apple Engineering and Technology,Shandong Agricultrural University

Web Site Designing & Administration Shizhong Zhang,Guanghui Chen and Yukun Liu ; IE 8 & 1600×900 Resolution Suggested