AppleGFDB:The Apple Gene Function & Gene Family DataBase v1.0
Locus Search:

 

miR397a

miR397a  

Mature Sequence:5'-TCATTGAGTGCAGCGTTGATG-3'

Precursor Sequence:

GATCCAGATTGAAGAAACATCATTGAGTGCAGCGTTGATGAAAGTCCGTATTCCTTWCGA
ATCTTCATTAGGCATCGGAAACTTTCGTCAGCTGTGCACCCAATTATGTTTCTATCCATT
TTGGCAAAGTGCTCAGCTATTATTTCAATTTTCGACAATATTATGGTAACT

Genome Location:Chr5:2667980..2667960
Precursor Coordinates:181..352
MFE:-49.3
MFEI:0.76
GC:38.01
Plant Homologs:

aly-miR397a;aly-miR397b;ath-miR397b;ath-miR397a;bna-miR397b;bna-miR397a;sly-miR397;vvi-miR397a;csi-miR397;hvu-miR397;pab-miR397;rco-miR397;zma-miR397b;zma-miR397a;bdi-miR397;osa-miR397a;osa-miR397b;ptc-miR397a;ptc-miR397b;sbi-miR397;

Structure:
Target:MDP0000240772 
Target Start:1254 
Target End:1274 
miRNA Aligned Fragment:5'-UCAUUGAGUGCAGCGUUGAUG-3' 
Target Aligned Fragment:3'- AGUAACUCACGUCGUAACUAC -5' 
Inhibition Type:Cleavage 
MDP0000240772 
Target:MDP0000237964 
Target Start:697 
Target End:716 
miRNA Aligned Fragment:5'-UCAUUGAGUGCAGCGUUGAU-3' 
Target Aligned Fragment:3'- AGUAACUCGCGUCGCAACUA -5' 
Inhibition Type:Cleavage 
MDP0000237964 
Target:MDP0000126274 
Target Start:667 
Target End:686 
miRNA Aligned Fragment:5'-UCAUUGAGUGCAGCGUUGAU-3' 
Target Aligned Fragment:3'- CAUAACUCACGUCGCAACUA -5' 
Inhibition Type:Cleavage 
MDP0000126274 
Target:MDP0000149146 
Target Start:667 
Target End:686 
miRNA Aligned Fragment:5'-UCAUUGAGUGCAGCGUUGAU-3' 
Target Aligned Fragment:3'- CAUAACUCACGUCGCAACUA -5' 
Inhibition Type:Cleavage 
MDP0000149146 
Target:MDP0000230007 
Target Start:66 
Target End:86 
miRNA Aligned Fragment:5'-UCAUUGAGUGCAGCGUUGAUG-3' 
Target Aligned Fragment:3'- AGUAACUCGUGUUGCAGUUAU -5' 
Inhibition Type:Cleavage 
MDP0000230007 
Target:MDP0000500938 
Target Start:66 
Target End:86 
miRNA Aligned Fragment:5'-UCAUUGAGUGCAGCGUUGAUG-3' 
Target Aligned Fragment:3'- AGUAACUCGUGUUGCAGUUAU -5' 
Inhibition Type:Cleavage 
MDP0000500938 
Target:MDP0000739375 
Target Start:66 
Target End:86 
miRNA Aligned Fragment:5'-UCAUUGAGUGCAGCGUUGAUG-3' 
Target Aligned Fragment:3'- AGUAACUCGUGUUGCAGUUAU -5' 
Inhibition Type:Cleavage 
MDP0000739375 
Target:MDP0000299415 
Target Start:66 
Target End:86 
miRNA Aligned Fragment:5'-UCAUUGAGUGCAGCGUUGAUG-3' 
Target Aligned Fragment:3'- AGUAACUCGUGUUGCAGUUAU -5' 
Inhibition Type:Cleavage 
MDP0000299415 
Target:MDP0000192322 
Target Start:667 
Target End:686 
miRNA Aligned Fragment:5'-UCAUUGAGUGCAGCGUUGAU-3' 
Target Aligned Fragment:3'- AAUAACUCACGUUGUAACUA -5' 
Inhibition Type:Cleavage 
MDP0000192322 
Target:MDP0000226556 
Target Start:667 
Target End:686 
miRNA Aligned Fragment:5'-UCAUUGAGUGCAGCGUUGAU-3' 
Target Aligned Fragment:3'- AAUAACUCACGUUGUAACUA -5' 
Inhibition Type:Cleavage 
MDP0000226556 
Target:MDP0000174639 
Target Start:449 
Target End:469 
miRNA Aligned Fragment:5'-UCAUUGAGUGCAGCGUUGAUG-3' 
Target Aligned Fragment:3'- AGUAGCUCCCGUCGCCACUAC -5' 
Inhibition Type:Translation 
MDP0000174639 
Target:MDP0000243556 
Target Start:845 
Target End:865 
miRNA Aligned Fragment:5'-UCAUUGAGUGCAGCGUUGAUG-3' 
Target Aligned Fragment:3'- ACUGACUCCCGUCGCAACUAC -5' 
Inhibition Type:Translation 
MDP0000243556 
Target:MDP0000280305 
Target Start:675 
Target End:695 
miRNA Aligned Fragment:5'-UCAUUGAGUGCAGCGUUGAUG-3' 
Target Aligned Fragment:3'- AGCAACUCACGACGCAACUAU -5' 
Inhibition Type:Cleavage 
MDP0000280305 
Target:MDP0000276889 
Target Start:1132 
Target End:1151 
miRNA Aligned Fragment:5'-UCAUUGAGUGCAGCGUUGAU-3' 
Target Aligned Fragment:3'- AGUAACUCACAUUGUGACUA -5' 
Inhibition Type:Translation 
MDP0000276889 
Target:MDP0000307655 
Target Start:681 
Target End:701 
miRNA Aligned Fragment:5'-UCAUUGAGUGCAGCGUUGAUG-3' 
Target Aligned Fragment:3'- AGCAACUCACGACGUAACUAU -5' 
Inhibition Type:Cleavage 
MDP0000307655 
Target:MDP0000252970 
Target Start:681 
Target End:701 
miRNA Aligned Fragment:5'-UCAUUGAGUGCAGCGUUGAUG-3' 
Target Aligned Fragment:3'- AGCAACUCACGACGUAACUAU -5' 
Inhibition Type:Cleavage 
MDP0000252970 
Data resource:
Varkonyi Gasic et al.
Wei et al.

All copyright are reserved by Prof. Huairui Shu 's lab at National Research Center for Apple Engineering and Technology,Shandong Agricultrural University

Web Site Designing & Administration Shizhong Zhang,Guanghui Chen and Yukun Liu ; IE 8 & 1600×900 Resolution Suggested