AppleGFDB:The Apple Gene Function & Gene Family DataBase v1.0
Locus Search:

 

miR397b

miR397b  

Mature Sequence:5'-ATTGAGTGCAGCGTTGATGAA-3'

Precursor Sequence:

_

Genome Location:Chr5:2667978..2667958
Precursor Coordinates:_
MFE:_
MFEI:_
GC:_
Plant Homologs:

_

Structure:
Target:MDP0000240772 
Target Start:1253 
Target End:1272 
miRNA Aligned Fragment:5'-AUUGAGUGCAGCGUUGAUGA-3' 
Target Aligned Fragment:3'- UAACUCACGUCGUAACUACU -5' 
Inhibition Type:Cleavage 
MDP0000240772 
Target:MDP0000126274 
Target Start:665 
Target End:684 
miRNA Aligned Fragment:5'-AUUGAGUGCAGCGUUGAUGA-3' 
Target Aligned Fragment:3'- UAACUCACGUCGCAACUAAU -5' 
Inhibition Type:Cleavage 
MDP0000126274 
Target:MDP0000149146 
Target Start:665 
Target End:684 
miRNA Aligned Fragment:5'-AUUGAGUGCAGCGUUGAUGA-3' 
Target Aligned Fragment:3'- UAACUCACGUCGCAACUAAU -5' 
Inhibition Type:Cleavage 
MDP0000149146 
Target:MDP0000243556 
Target Start:844 
Target End:863 
miRNA Aligned Fragment:5'-AUUGAGUGCAGCGUUGAUGA-3' 
Target Aligned Fragment:3'- UGACUCCCGUCGCAACUACU -5' 
Inhibition Type:Cleavage 
MDP0000243556 
Target:MDP0000175212 
Target Start:784 
Target End:804 
miRNA Aligned Fragment:5'-AUUGAGUGCAGCGUUGAUGAA-3' 
Target Aligned Fragment:3'- CAACUCGCGUCGCAACUAGUU -5' 
Inhibition Type:Cleavage 
MDP0000175212 
Target:MDP0000237964 
Target Start:695 
Target End:714 
miRNA Aligned Fragment:5'-AUUGAGUGCAGCGUUGAUGA-3' 
Target Aligned Fragment:3'- UAACUCGCGUCGCAACUAAU -5' 
Inhibition Type:Cleavage 
MDP0000237964 
Target:MDP0000237964 
Target Start:2372 
Target End:2391 
miRNA Aligned Fragment:5'-AUUGAGUGCAGCGUUGAUGA-3' 
Target Aligned Fragment:3'- UAACUCACGACGCAACUAUU -5' 
Inhibition Type:Translation 
MDP0000237964 
Target:MDP0000192322 
Target Start:665 
Target End:684 
miRNA Aligned Fragment:5'-AUUGAGUGCAGCGUUGAUGA-3' 
Target Aligned Fragment:3'- UAACUCACGUUGUAACUAAU -5' 
Inhibition Type:Cleavage 
MDP0000192322 
Target:MDP0000226556 
Target Start:665 
Target End:684 
miRNA Aligned Fragment:5'-AUUGAGUGCAGCGUUGAUGA-3' 
Target Aligned Fragment:3'- UAACUCACGUUGUAACUAAU -5' 
Inhibition Type:Cleavage 
MDP0000226556 
Target:MDP0000280305 
Target Start:674 
Target End:693 
miRNA Aligned Fragment:5'-AUUGAGUGCAGCGUUGAUGA-3' 
Target Aligned Fragment:3'- CAACUCACGACGCAACUAUU -5' 
Inhibition Type:Translation 
MDP0000280305 
Target:MDP0000252970 
Target Start:680 
Target End:699 
miRNA Aligned Fragment:5'-AUUGAGUGCAGCGUUGAUGA-3' 
Target Aligned Fragment:3'- CAACUCACGACGUAACUAUU -5' 
Inhibition Type:Translation 
MDP0000252970 
Target:MDP0000307655 
Target Start:680 
Target End:699 
miRNA Aligned Fragment:5'-AUUGAGUGCAGCGUUGAUGA-3' 
Target Aligned Fragment:3'- CAACUCACGACGUAACUAUU -5' 
Inhibition Type:Translation 
MDP0000307655 
Target:MDP0000212954 
Target Start:203 
Target End:222 
miRNA Aligned Fragment:5'-AUUGAGUGCAGCGUUGAUGA-3' 
Target Aligned Fragment:3'- UGACUCCCGGCGCAACUACU -5' 
Inhibition Type:Translation 
MDP0000212954 
Target:MDP0000164958 
Target Start:939 
Target End:958 
miRNA Aligned Fragment:5'-AUUGAGUGCAGCGUUGAUGA-3' 
Target Aligned Fragment:3'- UGACUCAUGUUCCAGCUACU -5' 
Inhibition Type:Cleavage 
MDP0000164958 
Data resource:
Wei et al.

All copyright are reserved by Prof. Huairui Shu 's lab at National Research Center for Apple Engineering and Technology,Shandong Agricultrural University

Web Site Designing & Administration Shizhong Zhang,Guanghui Chen and Yukun Liu ; IE 8 & 1600×900 Resolution Suggested