AppleGFDB:The Apple Gene Function & Gene Family DataBase v1.0
Locus Search:

 

miR398a

miR398a  

Mature Sequence:5'-TGTGTTCTCAGGTCACCCCTT-3'

Precursor Sequence:

ATCCCCGTTCATATAGCARATGGTCACCCCAAAGGTGTGAAACTGAGAACACAAATGGTG
TTGYCYGCGACAAACATTGTAAGCACTGCTTACGCATTTTGTGTTCTCAGGTCACCCCTT
TGGGGCACCTTGCTTACATGCACTTCGTATYTGAGTTCAAGATATYSAAT

Genome Location:Chr16:2628870..2628890
Precursor Coordinates:101..271
MFE:-59.9
MFEI:0.82
GC:42.94
Plant Homologs:

ahy-miR398;aly-miR398b;aly-miR398a;ath-miR398c;ath-miR398a;ath-miR398b;ghr-miR398;tae-miR398;vvi-miR398b;vvi-miR398a;vvi-miR398c;aqc-miR398a;aqc-miR398b;bol-miR398a;csi-miR398;gma-miR398b;gma-miR398a;mtr-miR398a;mtr-miR398b;mtr-miR398c;rco-miR398a;rco-miR398b;zma-miR398a;zma-miR398b;gra-miR398;osa-miR398b;osa-miR398a;ptc-miR398b;ptc-miR398c;ptc-miR398a;sbi-miR398;

Structure:
Target:MDP0000152817 
Target Start:1453 
Target End:1473 
miRNA Aligned Fragment:5'-UGUGUUCUCAGGUCACCCCUU-3' 
Target Aligned Fragment:3'- AUGAAAGAGUCCGGUGGGGAA -5' 
Inhibition Type:Cleavage 
MDP0000152817 
Target:MDP0000148985 
Target Start:240 
Target End:260 
miRNA Aligned Fragment:5'-UGUGUUCUCAGGUCACCCCUU-3' 
Target Aligned Fragment:3'- ACACAAGAGUUUAGGGGCGAA -5' 
Inhibition Type:Cleavage 
MDP0000148985 
Target:MDP0000166076 
Target Start:215 
Target End:234 
miRNA Aligned Fragment:5'-UGUGUUCUCAGGUCACCCCU-3' 
Target Aligned Fragment:3'- ACACAAGAGUYCAACGGGGA -5' 
Inhibition Type:Cleavage 
MDP0000166076 
Target:MDP0000178745 
Target Start:935 
Target End:954 
miRNA Aligned Fragment:5'-UGUGUUCUCAGGUCACCCCUU-3' 
Target Aligned Fragment:3'- ACACAAGAGU-CAGUGGAGAA -5' 
Inhibition Type:Translation 
MDP0000178745 
Data resource:
Gleave, AP et al.
Huaping Yu et al.
microPC
mirNEST
Varkonyi Gasic et al.
Wei et al.

All copyright are reserved by Prof. Huairui Shu 's lab at National Research Center for Apple Engineering and Technology,Shandong Agricultrural University

Web Site Designing & Administration Shizhong Zhang,Guanghui Chen and Yukun Liu ; IE 8 & 1600×900 Resolution Suggested