AppleGFDB:The Apple Gene Function & Gene Family DataBase v1.0
Locus Search:

 

miR398b

miR398b  

Mature Sequence:5'-TGTGTTCTCAGGTCGCCCCTG-3'

Precursor Sequence:

TTCTAAGGCAAGGAAGTTGTACAGAGATAAGCCAAAGCGGTAGAGGGGTTCCACAGGAGT
GACCTGAGATCACATGTAGCATTTATGTATTGCGCTTGATGTGTTCTCAGGTCGCCCCTG
CGGTACCTTCTCTACCATATCATTGCACTGCTGTAGATTTGAATGGACAT

Genome Location:Chr3:20116396..20116416
Precursor Coordinates:101..271
MFE:-67.52
MFEI:0.85
GC:46.47
Plant Homologs:

ahy-miR398;aly-miR398b;aly-miR398a;ath-miR398c;ath-miR398a;ath-miR398b;ghr-miR398;tae-miR398;vvi-miR398b;vvi-miR398a;vvi-miR398c;aqc-miR398a;aqc-miR398b;bol-miR398a;csi-miR398;gma-miR398b;gma-miR398a;mtr-miR398a;mtr-miR398b;mtr-miR398c;rco-miR398a;rco-miR398b;zma-miR398a;zma-miR398b;gra-miR398;osa-miR398b;osa-miR398a;ptc-miR398b;ptc-miR398c;ptc-miR398a;sbi-miR398;

Structure:
Target:MDP0000166076 
Target Start:214 
Target End:234 
miRNA Aligned Fragment:5'-UGUGUUCUCAGGUCGCCCCUG-3' 
Target Aligned Fragment:3'- ACACAAGAGUYCAACGGGGAC -5' 
Inhibition Type:Cleavage 
MDP0000166076 
Target:MDP0000821430 
Target Start:33 
Target End:54 
miRNA Aligned Fragment:5'-UGUGUUC-UCAGGUCGCCCCUG-3' 
Target Aligned Fragment:3'- ACACAAGCAGUCCAGCGGGAAC -5' 
Inhibition Type:Cleavage 
MDP0000821430 
Target:MDP0000217046 
Target Start:24 
Target End:45 
miRNA Aligned Fragment:5'-UGUGUUC-UCAGGUCGCCCCUG-3' 
Target Aligned Fragment:3'- ACACAAGCAGUCCAGCGGGAAC -5' 
Inhibition Type:Cleavage 
MDP0000217046 
Target:MDP0000530255 
Target Start:33 
Target End:54 
miRNA Aligned Fragment:5'-UGUGUUC-UCAGGUCGCCCCUG-3' 
Target Aligned Fragment:3'- ACACAAGCAGUCCAGCGGGAAC -5' 
Inhibition Type:Cleavage 
MDP0000530255 
Target:MDP0000691261 
Target Start:317 
Target End:336 
miRNA Aligned Fragment:5'-UGUGUUCUCAGGUCGCCCCU-3' 
Target Aligned Fragment:3'- UCACGAGAGCUCAGCGGGGA -5' 
Inhibition Type:Translation 
MDP0000691261 
Target:MDP0000148985 
Target Start:241 
Target End:260 
miRNA Aligned Fragment:5'-UGUGUUCUCAGGUCGCCCCU-3' 
Target Aligned Fragment:3'- ACACAAGAGUUUAGGGGCGA -5' 
Inhibition Type:Cleavage 
MDP0000148985 
Data resource:
microPC
Wei et al.

All copyright are reserved by Prof. Huairui Shu 's lab at National Research Center for Apple Engineering and Technology,Shandong Agricultrural University

Web Site Designing & Administration Shizhong Zhang,Guanghui Chen and Yukun Liu ; IE 8 & 1600×900 Resolution Suggested