AppleGFDB:The Apple Gene Function & Gene Family DataBase v1.0
Locus Search:

 

miR398c

miR398c  

Mature Sequence:5'-TGTGTTCTCAGGTCGCCCCTG-3'

Precursor Sequence:

CAGGAGTGACCTGAGATCACATGTAGCATTTATGTATTGCACTTGATGTGTTCTCAGGTC
GCCCCTG

Genome Location:UN
Precursor Coordinates:_
MFE:_
MFEI:_
GC:_
Plant Homologs:

_

Structure:
Target:MDP0000166076 
Target Start:214 
Target End:234 
miRNA Aligned Fragment:5'-UGUGUUCUCAGGUCGCCCCUG-3' 
Target Aligned Fragment:3'- ACACAAGAGUYCAACGGGGAC -5' 
Inhibition Type:Cleavage 
MDP0000166076 
Target:MDP0000821430 
Target Start:33 
Target End:54 
miRNA Aligned Fragment:5'-UGUGUUC-UCAGGUCGCCCCUG-3' 
Target Aligned Fragment:3'- ACACAAGCAGUCCAGCGGGAAC -5' 
Inhibition Type:Cleavage 
MDP0000821430 
Target:MDP0000217046 
Target Start:24 
Target End:45 
miRNA Aligned Fragment:5'-UGUGUUC-UCAGGUCGCCCCUG-3' 
Target Aligned Fragment:3'- ACACAAGCAGUCCAGCGGGAAC -5' 
Inhibition Type:Cleavage 
MDP0000217046 
Target:MDP0000530255 
Target Start:33 
Target End:54 
miRNA Aligned Fragment:5'-UGUGUUC-UCAGGUCGCCCCUG-3' 
Target Aligned Fragment:3'- ACACAAGCAGUCCAGCGGGAAC -5' 
Inhibition Type:Cleavage 
MDP0000530255 
Target:MDP0000691261 
Target Start:317 
Target End:336 
miRNA Aligned Fragment:5'-UGUGUUCUCAGGUCGCCCCU-3' 
Target Aligned Fragment:3'- UCACGAGAGCUCAGCGGGGA -5' 
Inhibition Type:Translation 
MDP0000691261 
Target:MDP0000148985 
Target Start:241 
Target End:260 
miRNA Aligned Fragment:5'-UGUGUUCUCAGGUCGCCCCU-3' 
Target Aligned Fragment:3'- ACACAAGAGUUUAGGGGCGA -5' 
Inhibition Type:Cleavage 
MDP0000148985 
Data resource:
microPC

All copyright are reserved by Prof. Huairui Shu 's lab at National Research Center for Apple Engineering and Technology,Shandong Agricultrural University

Web Site Designing & Administration Shizhong Zhang,Guanghui Chen and Yukun Liu ; IE 8 & 1600×900 Resolution Suggested