AppleGFDB:The Apple Gene Function & Gene Family DataBase v1.0
Locus Search:

 

miR399

miR399  

Mature Sequence:5'-TGCCAAAGGAGATTTGCCC-3'

Precursor Sequence:

_

Genome Location:UN
Precursor Coordinates:_
MFE:_
MFEI:_
GC:_
Plant Homologs:

_

Structure:
Target:MDP0000508371 
Target Start:248 
Target End:268 
miRNA Aligned Fragment:5'-UGCCAAAGGAGAGUUGCCCUG-3' 
Target Aligned Fragment:3'- UCGGUUUCUUCUCGACCGGAC -5' 
Inhibition Type:Cleavage 
MDP0000508371 
Target:MDP0000717558 
Target Start:248 
Target End:268 
miRNA Aligned Fragment:5'-UGCCAAAGGAGAGUUGCCCUG-3' 
Target Aligned Fragment:3'- UCGGUUUCUUCUCGACCGGAC -5' 
Inhibition Type:Cleavage 
MDP0000717558 
Target:MDP0000278249 
Target Start:248 
Target End:268 
miRNA Aligned Fragment:5'-UGCCAAAGGAGAGUUGCCCUG-3' 
Target Aligned Fragment:3'- UCGGUUUCUUCUCGACCGGAC -5' 
Inhibition Type:Cleavage 
MDP0000278249 
Target:MDP0000900762 
Target Start:378 
Target End:397 
miRNA Aligned Fragment:5'-UGCCAAAGGAGAGUUGCCCU-3' 
Target Aligned Fragment:3'- GUGGUUUCCUUACAACGGGA -5' 
Inhibition Type:Cleavage 
MDP0000900762 
Target:MDP0000742438 
Target Start:2013 
Target End:2033 
miRNA Aligned Fragment:5'-UGCCAAAGGAGAAUUGCCCUG-3' 
Target Aligned Fragment:3'- GUGGUUUCUUCUUAAUGUGAU -5' 
Inhibition Type:Cleavage 
MDP0000742438 
Target:MDP0000271176 
Target Start:482 
Target End:501 
miRNA Aligned Fragment:5'-UGCCAAAGGAGAAUUGCCCU-3' 
Target Aligned Fragment:3'- AAGGUUUCCUCUUAAUUGGA -5' 
Inhibition Type:Cleavage 
MDP0000271176 
Target:MDP0000159358 
Target Start:3301 
Target End:3321 
miRNA Aligned Fragment:5'-UGCCAAAGGAGAUUUGCCCAG-3' 
Target Aligned Fragment:3'- ACCGUUUUCUCGAAACGGGUU -5' 
Inhibition Type:Cleavage 
MDP0000159358 
Target:MDP0000284678 
Target Start:491 
Target End:510 
miRNA Aligned Fragment:5'-UGCCAAAGGAGAUUUGCCCA-3' 
Target Aligned Fragment:3'- AAGGUUUCCUUAAAACGGGU -5' 
Inhibition Type:Cleavage 
MDP0000284678 
Target:MDP0000612779 
Target Start:491 
Target End:510 
miRNA Aligned Fragment:5'-UGCCAAAGGAGAUUUGCCCA-3' 
Target Aligned Fragment:3'- AAGGUUUCCUUAAAACGGGU -5' 
Inhibition Type:Cleavage 
MDP0000612779 
Target:MDP0000326866 
Target Start:140 
Target End:159 
miRNA Aligned Fragment:5'-UGCCAAAGGAGAUUUGCCCA-3' 
Target Aligned Fragment:3'- ACGGUUUCCUCAAAACGCGC -5' 
Inhibition Type:Cleavage 
MDP0000326866 
Target:MDP0000900762 
Target Start:378 
Target End:397 
miRNA Aligned Fragment:5'-UGCCAAAGGAGAGUUGCCCU-3' 
Target Aligned Fragment:3'- GUGGUUUCCUUACAACGGGA -5' 
Inhibition Type:Cleavage 
MDP0000900762 
Target:MDP0000278249 
Target Start:249 
Target End:268 
miRNA Aligned Fragment:5'-UGCCAAAGGAGAGUUGCCCU-3' 
Target Aligned Fragment:3'- UCGGUUUCUUCUCGACCGGA -5' 
Inhibition Type:Cleavage 
MDP0000278249 
Target:MDP0000508371 
Target Start:249 
Target End:268 
miRNA Aligned Fragment:5'-UGCCAAAGGAGAGUUGCCCU-3' 
Target Aligned Fragment:3'- UCGGUUUCUUCUCGACCGGA -5' 
Inhibition Type:Cleavage 
MDP0000508371 
Target:MDP0000717558 
Target Start:249 
Target End:268 
miRNA Aligned Fragment:5'-UGCCAAAGGAGAGUUGCCCU-3' 
Target Aligned Fragment:3'- UCGGUUUCUUCUCGACCGGA -5' 
Inhibition Type:Cleavage 
MDP0000717558 
Target:MDP0000200335 
Target Start:420 
Target End:439 
miRNA Aligned Fragment:5'-UGCCAAAGGAGAGUUGCCCU-3' 
Target Aligned Fragment:3'- ACGGUUUUCUCUCGAAGGCA -5' 
Inhibition Type:Cleavage 
MDP0000200335 
Target:MDP0000248808 
Target Start:399 
Target End:418 
miRNA Aligned Fragment:5'-UGCCAAAGGAGAGUUGCCCU-3' 
Target Aligned Fragment:3'- ACGGUUUUCUCUCGAAGGCA -5' 
Inhibition Type:Cleavage 
MDP0000248808 
Data resource:
Huaping Yu et al.
Wei et al.
Wei et al.
Wei et al.
Wei et al.
Wei et al.

All copyright are reserved by Prof. Huairui Shu 's lab at National Research Center for Apple Engineering and Technology,Shandong Agricultrural University

Web Site Designing & Administration Shizhong Zhang,Guanghui Chen and Yukun Liu ; IE 8 & 1600×900 Resolution Suggested