AppleGFDB:The Apple Gene Function & Gene Family DataBase v1.0
Locus Search:

 

miR399a

miR399a  

Mature Sequence:5'-TGCCAAAGGAGAATTGCCCTG-3'

Precursor Sequence:

GACTGTGCTGAGGGTAGGGATGAATAACAGTGCAAATCTCCTTTGGCAGAAATGATTCTG
GTGCATTTACTCTTGAGTACTACCACTGGATATGCTTTCTGCCAAAGGAGAATTGCCCTG
CAATTCAATAACTCTACCAATGAATATCCAAATATGTGTGTGTGTGTSC

Genome Location:Chr5:5621002..5621022
Precursor Coordinates:101..270
MFE:-60.4
MFEI:0.86
GC:41.42
Plant Homologs:

tae-miR399;vvi-miR399a;vvi-miR399h;csi-miR399c;csi-miR399e;zma-miR399h;zma-miR399a;zma-miR399c;bdi-miR399;osa-miR399b;osa-miR399a;osa-miR399c;ptc-miR399g;ptc-miR399f;sbi-miR399a;sbi-miR399c;sbi-miR399j;sbi-miR399h;

Structure:
Target:MDP0000742438 
Target Start:2013 
Target End:2033 
miRNA Aligned Fragment:5'-UGCCAAAGGAGAAUUGCCCUG-3' 
Target Aligned Fragment:3'- GUGGUUUCUUCUUAAUGUGAU -5' 
Inhibition Type:Cleavage 
MDP0000742438 
Target:MDP0000271176 
Target Start:482 
Target End:501 
miRNA Aligned Fragment:5'-UGCCAAAGGAGAAUUGCCCU-3' 
Target Aligned Fragment:3'- AAGGUUUCCUCUUAAUUGGA -5' 
Inhibition Type:Cleavage 
MDP0000271176 
Data resource:
Wei et al.

All copyright are reserved by Prof. Huairui Shu 's lab at National Research Center for Apple Engineering and Technology,Shandong Agricultrural University

Web Site Designing & Administration Shizhong Zhang,Guanghui Chen and Yukun Liu ; IE 8 & 1600×900 Resolution Suggested