AppleGFDB:The Apple Gene Function & Gene Family DataBase v1.0
Locus Search:

 

miR399b

miR399b  

Mature Sequence:5'-TGCCAAAGGAGAGTTGCCCTG-3'

Precursor Sequence:

TATGCAAGAAGTGCTTGTCTAATAAGCAAATCAGTCATAGGGCTCCTCCCTCTTGGCAGG
CACTGGTGTATGGTGCAACTACAGTCACTTTCATTGACCTGCCAAAGGAGAGTTGCCCTG
CGATTGCTTTGGCTTAATGAACTGTGCAGTCTGATCATGCGGCAGAGATGC

Genome Location:Chr1:25019425..25019405
Precursor Coordinates:101..272
MFE:-60.7
MFEI:0.73
GC:48.54
Plant Homologs:

aly-miR399b;aly-miR399c;ath-miR399b;ath-miR399c;pvu-miR399a;vvi-miR399b;vvi-miR399i;vvi-miR399c;csi-miR399d;mtr-miR399p;mtr-miR399l;rco-miR399a;zma-miR399e;zma-miR399i;zma-miR399j;osa-miR399d;sbi-miR399i;sbi-miR399d;

Structure:
Target:MDP0000508371 
Target Start:248 
Target End:268 
miRNA Aligned Fragment:5'-UGCCAAAGGAGAGUUGCCCUG-3' 
Target Aligned Fragment:3'- UCGGUUUCUUCUCGACCGGAC -5' 
Inhibition Type:Cleavage 
MDP0000508371 
Target:MDP0000717558 
Target Start:248 
Target End:268 
miRNA Aligned Fragment:5'-UGCCAAAGGAGAGUUGCCCUG-3' 
Target Aligned Fragment:3'- UCGGUUUCUUCUCGACCGGAC -5' 
Inhibition Type:Cleavage 
MDP0000717558 
Target:MDP0000278249 
Target Start:248 
Target End:268 
miRNA Aligned Fragment:5'-UGCCAAAGGAGAGUUGCCCUG-3' 
Target Aligned Fragment:3'- UCGGUUUCUUCUCGACCGGAC -5' 
Inhibition Type:Cleavage 
MDP0000278249 
Target:MDP0000900762 
Target Start:378 
Target End:397 
miRNA Aligned Fragment:5'-UGCCAAAGGAGAGUUGCCCU-3' 
Target Aligned Fragment:3'- GUGGUUUCCUUACAACGGGA -5' 
Inhibition Type:Cleavage 
MDP0000900762 
Data resource:
Wei et al.

All copyright are reserved by Prof. Huairui Shu 's lab at National Research Center for Apple Engineering and Technology,Shandong Agricultrural University

Web Site Designing & Administration Shizhong Zhang,Guanghui Chen and Yukun Liu ; IE 8 & 1600×900 Resolution Suggested