AppleGFDB:The Apple Gene Function & Gene Family DataBase v1.0
Locus Search:

 

miR399e

miR399e  

Mature Sequence:5'-TGCCAAAGGAGATTTGCCCAG-3'

Precursor Sequence:

CTTTGGCAGACAACAATTATGAGATGCAWGTGTTGGCTTCATGCATTCCTGCCAAAGGAG
ATTTGCCCAGCAATTCTCCTGCCSCTTTGTTTCACCTACAAAAATTCTGTTGTTAATAAT
TCGCTTTTGGATATAGATGTTTTGATTTATATAGAGTCATTCAAATTTATTGATTACAAA
AATGGTACGGTTAGTCTATATCTGTAAGTATTTAGCAACAC

Genome Location:Chr5:5623741..5623721
Precursor Coordinates:151..372
MFE:-53.3
MFEI:0.7
GC:34.39
Plant Homologs:

aly-miR399a;aly-miR399g;aly-miR399e;aly-miR399f;aly-miR399i;aly-miR399h;aly-miR399d;aly-miR399j;ath-miR399f;ath-miR399d;ath-miR399a;ath-miR399e;bna-miR399;ghr-miR399d;vvi-miR399d;vvi-miR399e;vvi-miR399g;csi-miR399a;mtr-miR399a;mtr-miR399i;mtr-miR399c;mtr-miR399e;mtr-miR399g;mtr-miR399f;mtr-miR399h;rco-miR399b;rco-miR399f;rco-miR399e;rco-miR399c;osa-miR399e;osa-miR399f;osa-miR399g;ptc-miR399b;ptc-miR399k;ptc-miR399a;ptc-miR399j;ptc-miR399c;sbi-miR399e;sbi-miR399f;

Structure:
Target:MDP0000159358 
Target Start:3301 
Target End:3321 
miRNA Aligned Fragment:5'-UGCCAAAGGAGAUUUGCCCAG-3' 
Target Aligned Fragment:3'- ACCGUUUUCUCGAAACGGGUU -5' 
Inhibition Type:Cleavage 
MDP0000159358 
Target:MDP0000284678 
Target Start:491 
Target End:510 
miRNA Aligned Fragment:5'-UGCCAAAGGAGAUUUGCCCA-3' 
Target Aligned Fragment:3'- AAGGUUUCCUUAAAACGGGU -5' 
Inhibition Type:Cleavage 
MDP0000284678 
Target:MDP0000612779 
Target Start:491 
Target End:510 
miRNA Aligned Fragment:5'-UGCCAAAGGAGAUUUGCCCA-3' 
Target Aligned Fragment:3'- AAGGUUUCCUUAAAACGGGU -5' 
Inhibition Type:Cleavage 
MDP0000612779 
Target:MDP0000326866 
Target Start:140 
Target End:159 
miRNA Aligned Fragment:5'-UGCCAAAGGAGAUUUGCCCA-3' 
Target Aligned Fragment:3'- ACGGUUUCCUCAAAACGCGC -5' 
Inhibition Type:Cleavage 
MDP0000326866 
Data resource:
Wei et al.

All copyright are reserved by Prof. Huairui Shu 's lab at National Research Center for Apple Engineering and Technology,Shandong Agricultrural University

Web Site Designing & Administration Shizhong Zhang,Guanghui Chen and Yukun Liu ; IE 8 & 1600×900 Resolution Suggested