AppleGFDB:The Apple Gene Function & Gene Family DataBase v1.0
Locus Search:

 

miR399j

miR399j  

Mature Sequence:5'-TGCCAAAGGAGAGTTGCCCTA-3'

Precursor Sequence:

GAGCGAATTAGTTGTAGGGCTTCTCTCCGATGGCAGGAAATATTAATGGTCATGAATCAT
GGAAGCATGGATTTTTGTGTTCTCTCATGAGTTATGACCTGCCAAAGGAGAGTTGCCCTA
CGACTGCTTTTGCTTAATTAATGTGTTCATCTGAAGGTACAAAGACGGTGT

Genome Location:Chr6:13277960..13277940
Precursor Coordinates:101..272
MFE:-69.8
MFEI:0.97
GC:42.11
Plant Homologs:

aly-miR399a;aly-miR399a;aly-miR399b;aly-miR399b;aly-miR399g;aly-miR399g;aly-miR399e;aly-miR399e;aly-miR399f;aly-miR399f;aly-miR399i;aly-miR399i;aly-miR399c;aly-miR399c;aly-miR399h;aly-miR399h;aly-miR399d;aly-miR399d;aly-miR399j;aly-miR399j;ath-miR399f;ath-miR399f;ath-miR399d;ath-miR399d;ath-miR399a;ath-miR399a;ath-miR399b;ath-miR399b;ath-miR399e;ath-miR399e;ath-miR399c;ath-miR399c;bna-miR399;bna-miR399;ghr-miR399d;ghr-miR399d;ghr-miR399c;ghr-miR399c;pvu-miR399a;pvu-miR399a;sly-miR399;sly-miR399;tae-miR399;tae-miR399;vvi-miR399b;vvi-miR399b;vvi-miR399d;vvi-miR399d;vvi-miR399a;vvi-miR399a;vvi-miR399e;vvi-miR399e;vvi-miR399i;vvi-miR399i;vvi-miR399g;vvi-miR399g;vvi-miR399h;vvi-miR399h;vvi-miR399c;vvi-miR399c;aqc-miR399;aqc-miR399;csi-miR399c;csi-miR399c;csi-miR399a;csi-miR399a;csi-miR399b;csi-miR399b;csi-miR399e;csi-miR399e;csi-miR399d;csi-miR399d;mtr-miR399d;mtr-miR399d;mtr-miR399q;mtr-miR399q;mtr-miR399m;mtr-miR399m;mtr-miR399a;mtr-miR399a;mtr-miR399p;mtr-miR399p;mtr-miR399i;mtr-miR399i;mtr-miR399c;mtr-miR399c;mtr-miR399e;mtr-miR399e;mtr-miR399g;mtr-miR399g;mtr-miR399l;mtr-miR399l;mtr-miR399f;mtr-miR399f;mtr-miR399o;mtr-miR399o;mtr-miR399b;mtr-miR399b;mtr-miR399n;mtr-miR399n;mtr-miR399h;mtr-miR399h;rco-miR399b;rco-miR399b;rco-miR399f;rco-miR399f;rco-miR399d;rco-miR399d;rco-miR399a;rco-miR399a;rco-miR399e;rco-miR399e;rco-miR399c;rco-miR399c;zma-miR399e;zma-miR399e;zma-miR399h;zma-miR399h;zma-miR399a;zma-miR399a;zma-miR399b;zma-miR399b;zma-miR399i;zma-miR399i;zma-miR399j;zma-miR399j;zma-miR399c;zma-miR399c;zma-miR399d;zma-miR399d;bdi-miR399;bdi-miR399;osa-miR399h;osa-miR399h;osa-miR399e;osa-miR399e;osa-miR399d;osa-miR399d;osa-miR399b;osa-miR399b;osa-miR399i;osa-miR399i;osa-miR399f;osa-miR399f;osa-miR399a;osa-miR399a;osa-miR399j;osa-miR399j;osa-miR399g;osa-miR399g;osa-miR399c;osa-miR399c;ptc-miR399b;ptc-miR399b;ptc-miR399i;ptc-miR399i;ptc-miR399g;ptc-miR399g;ptc-miR399k;ptc-miR399k;ptc-miR399f;ptc-miR399f;ptc-miR399a;ptc-miR399a;ptc-miR399j;ptc-miR399j;ptc-miR399h;ptc-miR399h;ptc-miR399l;ptc-miR399l;ptc-miR399c;ptc-miR399c;sbi-miR399i;sbi-miR399i;sbi-miR399a;sbi-miR399a;sbi-miR399e;sbi-miR399e;sbi-miR399c;sbi-miR399c;sbi-miR399b;sbi-miR399b;sbi-miR399f;sbi-miR399f;sbi-miR399j;sbi-miR399j;sbi-miR399d;sbi-miR399d;sbi-miR399h;sbi-miR399h;

Structure:
Target:MDP0000900762 
Target Start:378 
Target End:397 
miRNA Aligned Fragment:5'-UGCCAAAGGAGAGUUGCCCU-3' 
Target Aligned Fragment:3'- GUGGUUUCCUUACAACGGGA -5' 
Inhibition Type:Cleavage 
MDP0000900762 
Target:MDP0000278249 
Target Start:249 
Target End:268 
miRNA Aligned Fragment:5'-UGCCAAAGGAGAGUUGCCCU-3' 
Target Aligned Fragment:3'- UCGGUUUCUUCUCGACCGGA -5' 
Inhibition Type:Cleavage 
MDP0000278249 
Target:MDP0000508371 
Target Start:249 
Target End:268 
miRNA Aligned Fragment:5'-UGCCAAAGGAGAGUUGCCCU-3' 
Target Aligned Fragment:3'- UCGGUUUCUUCUCGACCGGA -5' 
Inhibition Type:Cleavage 
MDP0000508371 
Target:MDP0000717558 
Target Start:249 
Target End:268 
miRNA Aligned Fragment:5'-UGCCAAAGGAGAGUUGCCCU-3' 
Target Aligned Fragment:3'- UCGGUUUCUUCUCGACCGGA -5' 
Inhibition Type:Cleavage 
MDP0000717558 
Target:MDP0000200335 
Target Start:420 
Target End:439 
miRNA Aligned Fragment:5'-UGCCAAAGGAGAGUUGCCCU-3' 
Target Aligned Fragment:3'- ACGGUUUUCUCUCGAAGGCA -5' 
Inhibition Type:Cleavage 
MDP0000200335 
Target:MDP0000248808 
Target Start:399 
Target End:418 
miRNA Aligned Fragment:5'-UGCCAAAGGAGAGUUGCCCU-3' 
Target Aligned Fragment:3'- ACGGUUUUCUCUCGAAGGCA -5' 
Inhibition Type:Cleavage 
MDP0000248808 
Data resource:
Wei et al.

All copyright are reserved by Prof. Huairui Shu 's lab at National Research Center for Apple Engineering and Technology,Shandong Agricultrural University

Web Site Designing & Administration Shizhong Zhang,Guanghui Chen and Yukun Liu ; IE 8 & 1600×900 Resolution Suggested