AppleGFDB:The Apple Gene Function & Gene Family DataBase v1.0
Locus Search:

 

miR403a

miR403a  

Mature Sequence:5'-TTAGATTCACGCACAAACTCG-3'

Precursor Sequence:

_

Genome Location:UN
Precursor Coordinates:_
MFE:_
MFEI:_
GC:_
Plant Homologs:

_

Structure:
Target:MDP0000175678 
Target Start:210 
Target End:230 
miRNA Aligned Fragment:5'-UUAGAUUCACGCACAAACUCG-3' 
Target Aligned Fragment:3'- AAUCAAAGUGGGUGUUUGAGC -5' 
Inhibition Type:Translation 
MDP0000175678 
Target:MDP0000272603 
Target Start:1980 
Target End:1999 
miRNA Aligned Fragment:5'-UUAGAUUCACGCACAAACUCG-3' 
Target Aligned Fragment:3'- AAUCUAGGUGU-UGUUUGAGU -5' 
Inhibition Type:Cleavage 
MDP0000272603 
Data resource:
Varkonyi Gasic et al.

All copyright are reserved by Prof. Huairui Shu 's lab at National Research Center for Apple Engineering and Technology,Shandong Agricultrural University

Web Site Designing & Administration Shizhong Zhang,Guanghui Chen and Yukun Liu ; IE 8 & 1600×900 Resolution Suggested