AppleGFDB:The Apple Gene Function & Gene Family DataBase v1.0
Locus Search:

 

miR408a

miR408a  

Mature Sequence:5'-ATGCACTGCCTCTTCCCTGGC-3'

Precursor Sequence:

_

Genome Location:UN
Precursor Coordinates:_
MFE:_
MFEI:_
GC:_
Plant Homologs:

_

Structure:
Target:MDP0000826600 
Target Start:894 
Target End:913 
miRNA Aligned Fragment:5'-AUGCACUGCCUCUUCCCUGG-3' 
Target Aligned Fragment:3'- UACGUGGCGGAGAAGGGAGG -5' 
Inhibition Type:Cleavage 
MDP0000826600 
Target:MDP0000281547 
Target Start:9 
Target End:28 
miRNA Aligned Fragment:5'-AUGCACUGCCUCUUCCCUGG-3' 
Target Aligned Fragment:3'- AACGUGACGUAGAAGGGACC -5' 
Inhibition Type:Translation 
MDP0000281547 
Target:MDP0000124552 
Target Start:297 
Target End:316 
miRNA Aligned Fragment:5'-AUGCACUGCCUCUUCCCUGG-3' 
Target Aligned Fragment:3'- GACGUGACGGAGAAGGGAAU -5' 
Inhibition Type:Cleavage 
MDP0000124552 
Target:MDP0000295340 
Target Start:6 
Target End:25 
miRNA Aligned Fragment:5'-AUGCACUGCCUCUUCCCUGG-3' 
Target Aligned Fragment:3'- GACGUGACGGAGAAGGGAAU -5' 
Inhibition Type:Cleavage 
MDP0000295340 
Target:MDP0000150953 
Target Start:6 
Target End:25 
miRNA Aligned Fragment:5'-AUGCACUGCCUCUUCCCUGG-3' 
Target Aligned Fragment:3'- GACGUGACGGAGAAGGGAAU -5' 
Inhibition Type:Cleavage 
MDP0000150953 
Target:MDP0000300452 
Target Start:212 
Target End:232 
miRNA Aligned Fragment:5'-AUGCACUGCCUCUUCCCUGGC-3' 
Target Aligned Fragment:3'- UACGUGACGGGAGAGGGACAG -5' 
Inhibition Type:Cleavage 
MDP0000300452 
Target:MDP0000707429 
Target Start:2215 
Target End:2235 
miRNA Aligned Fragment:5'-AUGCACUGCCUCUUCCCUGGC-3' 
Target Aligned Fragment:3'- UACGUGACGUAGAAGGAACAG -5' 
Inhibition Type:Translation 
MDP0000707429 
Data resource:
Varkonyi Gasic et al.

All copyright are reserved by Prof. Huairui Shu 's lab at National Research Center for Apple Engineering and Technology,Shandong Agricultrural University

Web Site Designing & Administration Shizhong Zhang,Guanghui Chen and Yukun Liu ; IE 8 & 1600×900 Resolution Suggested