AppleGFDB:The Apple Gene Function & Gene Family DataBase v1.0
Locus Search:

 

miR408b

miR408b  

Mature Sequence:5'-TGCACTGCCTCTTCCCTGGCT-3'

Precursor Sequence:

_

Genome Location:Chr17:24601444..24601424
Precursor Coordinates:_
MFE:_
MFEI:_
GC:_
Plant Homologs:

_

Structure:
Target:MDP0000281547 
Target Start:8 
Target End:27 
miRNA Aligned Fragment:5'-UGCACUGCCUCUUCCCUGGC-3' 
Target Aligned Fragment:3'- ACGUGACGUAGAAGGGACCA -5' 
Inhibition Type:Translation 
MDP0000281547 
Target:MDP0000295340 
Target Start:5 
Target End:24 
miRNA Aligned Fragment:5'-UGCACUGCCUCUUCCCUGGC-3' 
Target Aligned Fragment:3'- ACGUGACGGAGAAGGGAAUC -5' 
Inhibition Type:Cleavage 
MDP0000295340 
Target:MDP0000150953 
Target Start:5 
Target End:24 
miRNA Aligned Fragment:5'-UGCACUGCCUCUUCCCUGGC-3' 
Target Aligned Fragment:3'- ACGUGACGGAGAAGGGAAUC -5' 
Inhibition Type:Cleavage 
MDP0000150953 
Target:MDP0000033287 
Target Start:184 
Target End:204 
miRNA Aligned Fragment:5'-UGCACUGCCUCUUCCCUGGCU-3' 
Target Aligned Fragment:3'- ACCUGGCGGAGGAGGGACUGG -5' 
Inhibition Type:Cleavage 
MDP0000033287 
Target:MDP0000033287 
Target Start:217 
Target End:237 
miRNA Aligned Fragment:5'-UGCACUGCCUCUUCCCUGGCU-3' 
Target Aligned Fragment:3'- ACCUGGCGGAGGAGGGACUGG -5' 
Inhibition Type:Cleavage 
MDP0000033287 
Target:MDP0000300452 
Target Start:211 
Target End:231 
miRNA Aligned Fragment:5'-UGCACUGCCUCUUCCCUGGCU-3' 
Target Aligned Fragment:3'- ACGUGACGGGAGAGGGACAGG -5' 
Inhibition Type:Translation 
MDP0000300452 
Data resource:
Wei et al.

All copyright are reserved by Prof. Huairui Shu 's lab at National Research Center for Apple Engineering and Technology,Shandong Agricultrural University

Web Site Designing & Administration Shizhong Zhang,Guanghui Chen and Yukun Liu ; IE 8 & 1600×900 Resolution Suggested