AppleGFDB:The Apple Gene Function & Gene Family DataBase v1.0
Locus Search:

 

miR466b

miR466b  

Mature Sequence:5'-ATACATACACACACACATACAC-3'

Precursor Sequence:

_

Genome Location:Chr3:31544327..31544348
Precursor Coordinates:_
MFE:_
MFEI:_
GC:_
Plant Homologs:

_

Structure:
Target:MDP0000333896 
Target Start:116 
Target End:137 
miRNA Aligned Fragment:5'-AUACAUACACACACACAUACAC-3' 
Target Aligned Fragment:3'- UGUGUGUGUGUGUGUGUGUGUG -5' 
Inhibition Type:Cleavage 
MDP0000333896 
Target:MDP0000323007 
Target Start:13 
Target End:34 
miRNA Aligned Fragment:5'-AUACAUACACACACACAUACAC-3' 
Target Aligned Fragment:3'- UAUGUGUGUGUGUGUGURUGUS -5' 
Inhibition Type:Cleavage 
MDP0000323007 
Target:MDP0000155674 
Target Start:2036 
Target End:2057 
miRNA Aligned Fragment:5'-AUACAUACACACACACAUACAC-3' 
Target Aligned Fragment:3'- UGUGUAUGUGUGUGUGUGUAUG -5' 
Inhibition Type:Cleavage 
MDP0000155674 
Target:MDP0000333748 
Target Start:34 
Target End:55 
miRNA Aligned Fragment:5'-AUACAUACACACACACAUACAC-3' 
Target Aligned Fragment:3'- CAUGCAUGUGUGUGUGUGUGUG -5' 
Inhibition Type:Cleavage 
MDP0000333748 
Target:MDP0000512381 
Target Start:346 
Target End:366 
miRNA Aligned Fragment:5'-AUACAUACACACACACAUACA-3' 
Target Aligned Fragment:3'- UGUGUGCGUGUGUGUGUAUGU -5' 
Inhibition Type:Cleavage 
MDP0000512381 
Target:MDP0000267175 
Target Start:67 
Target End:88 
miRNA Aligned Fragment:5'-AUACAUACACACACACAUACAC-3' 
Target Aligned Fragment:3'- UAUAUAUCUGUGUGUGUGUGUG -5' 
Inhibition Type:Cleavage 
MDP0000267175 
Target:MDP0000219846 
Target Start:166 
Target End:186 
miRNA Aligned Fragment:5'-AUACAUACACACACACAUACA-3' 
Target Aligned Fragment:3'- UAUGUAGGUGUGUGUAUAUGU -5' 
Inhibition Type:Cleavage 
MDP0000219846 
Target:MDP0000324833 
Target Start:99 
Target End:119 
miRNA Aligned Fragment:5'-AUACAUACACACACACAUACA-3' 
Target Aligned Fragment:3'- UGUGUGUGUGUGUGUGUCUCU -5' 
Inhibition Type:Cleavage 
MDP0000324833 
Target:MDP0000266900 
Target Start:707 
Target End:726 
miRNA Aligned Fragment:5'-AUACAUACACACACACAUAC-3' 
Target Aligned Fragment:3'- UGUGUGUGGGUGUGUGUAUA -5' 
Inhibition Type:Translation 
MDP0000266900 
Target:MDP0000292704 
Target Start:1741 
Target End:1760 
miRNA Aligned Fragment:5'-AUACAUACACACACACAUAC-3' 
Target Aligned Fragment:3'- UAUGUGUGUGUGUGAGAAUG -5' 
Inhibition Type:Cleavage 
MDP0000292704 
Target:MDP0000291837 
Target Start:717 
Target End:739 
miRNA Aligned Fragment:5'-AUACAUACAC-ACACACAUACAC-3' 
Target Aligned Fragment:3'- UGUGUGUGUGUUGUGUGUAUGAG -5' 
Inhibition Type:Translation 
MDP0000291837 
Target:MDP0000294811 
Target Start:2453 
Target End:2473 
miRNA Aligned Fragment:5'-AUACAUACACACACACAUACA-3' 
Target Aligned Fragment:3'- UAUGUAUGUUUAUCUGUAUGU -5' 
Inhibition Type:Translation 
MDP0000294811 
Target:MDP0000155674 
Target Start:2039 
Target End:2059 
miRNA Aligned Fragment:5'-AUAUACAUACACACAUACACA-3' 
Target Aligned Fragment:3'- UAUGUGUAUGUGUGUGUGUGU -5' 
Inhibition Type:Cleavage 
MDP0000155674 
Target:MDP0000323007 
Target Start:14 
Target End:34 
miRNA Aligned Fragment:5'-AUAUACAUACACACAUACACA-3' 
Target Aligned Fragment:3'- UAUGUGUGUGUGUGUGURUGU -5' 
Inhibition Type:Cleavage 
MDP0000323007 
Target:MDP0000333896 
Target Start:115 
Target End:135 
miRNA Aligned Fragment:5'-AUAUACAUACACACAUACACA-3' 
Target Aligned Fragment:3'- UGUGUGUGUGUGUGUGUGUGU -5' 
Inhibition Type:Cleavage 
MDP0000333896 
Target:MDP0000267175 
Target Start:66 
Target End:86 
miRNA Aligned Fragment:5'-AUAUACAUACACACAUACACA-3' 
Target Aligned Fragment:3'- UAUAUCUGUGUGUGUGUGUGU -5' 
Inhibition Type:Cleavage 
MDP0000267175 
Target:MDP0000454891 
Target Start:1137 
Target End:1157 
miRNA Aligned Fragment:5'-AUAUACAUACACACAUACACA-3' 
Target Aligned Fragment:3'- UAUAUAUAUGUGUGUAUGUAU -5' 
Inhibition Type:Cleavage 
MDP0000454891 
Target:MDP0000490509 
Target Start:1146 
Target End:1166 
miRNA Aligned Fragment:5'-AUAUACAUACACACAUACACA-3' 
Target Aligned Fragment:3'- UAUAUAUAUGUGUGUAUGUAU -5' 
Inhibition Type:Cleavage 
MDP0000490509 
Target:MDP0000226096 
Target Start:937 
Target End:956 
miRNA Aligned Fragment:5'-AUAUACAUACACACAUACAC-3' 
Target Aligned Fragment:3'- AGUAUGUAUGUGUGUAUGUU -5' 
Inhibition Type:Cleavage 
MDP0000226096 
Target:MDP0000356405 
Target Start:90 
Target End:110 
miRNA Aligned Fragment:5'-AUAUACAUACACACAUACACA-3' 
Target Aligned Fragment:3'- UAUGUAUAUAUGUGUAUGUGU -5' 
Inhibition Type:Translation 
MDP0000356405 
Target:MDP0000357060 
Target Start:89 
Target End:110 
miRNA Aligned Fragment:5'-AUAUACAUAC-ACACAUACACA-3' 
Target Aligned Fragment:3'- UAUGUGUGUGUUGUGUAUGUGU -5' 
Inhibition Type:Translation 
MDP0000357060 
Target:MDP0000305012 
Target Start:1 
Target End:20 
miRNA Aligned Fragment:5'-AUAUACAUACACACAUACAC-3' 
Target Aligned Fragment:3'- UAUAUGUAUGUGGGUGUGUA -5' 
Inhibition Type:Cleavage 
MDP0000305012 
Target:MDP0000224017 
Target Start:707 
Target End:727 
miRNA Aligned Fragment:5'-AUAUACAUACACACAUACACA-3' 
Target Aligned Fragment:3'- UAUGUGUAUGUGUUUGGGUGU -5' 
Inhibition Type:Cleavage 
MDP0000224017 
Target:MDP0000193534 
Target Start:391 
Target End:410 
miRNA Aligned Fragment:5'-AUAUACAUACACACAUACAC-3' 
Target Aligned Fragment:3'- UAUAUGUAUGUGUGUCUCUC -5' 
Inhibition Type:Cleavage 
MDP0000193534 
Data resource:
Wei et al.

All copyright are reserved by Prof. Huairui Shu 's lab at National Research Center for Apple Engineering and Technology,Shandong Agricultrural University

Web Site Designing & Administration Shizhong Zhang,Guanghui Chen and Yukun Liu ; IE 8 & 1600×900 Resolution Suggested