AppleGFDB:The Apple Gene Function & Gene Family DataBase v1.0
Locus Search:

 

miR477c

miR477c  

Mature Sequence:5'-CTCTCCCTCAAAGGCTTCCA-3'

Precursor Sequence:

_

Genome Location:Chr14:22478508..22478489
Precursor Coordinates:_
MFE:_
MFEI:_
GC:_
Plant Homologs:

_

Structure:
Target:MDP0000431628 
Target Start:791 
Target End:810 
miRNA Aligned Fragment:5'-CUCUCCCUCAAAGGCUUCCA-3' 
Target Aligned Fragment:3'- GAGAGGGAGUUUCCGAAGGU -5' 
Inhibition Type:Cleavage 
MDP0000431628 
Target:MDP0000464809 
Target Start:2054 
Target End:2073 
miRNA Aligned Fragment:5'-CUCUCCCUCAAAGGCUUCCA-3' 
Target Aligned Fragment:3'- AGGAGGGAGUUUCCGAAGGU -5' 
Inhibition Type:Cleavage 
MDP0000464809 
Target:MDP0000147173 
Target Start:497 
Target End:516 
miRNA Aligned Fragment:5'-CUCUCCCUCAAAGGCUUCCA-3' 
Target Aligned Fragment:3'- AAGAGGGAGGUUCCGAAGGU -5' 
Inhibition Type:Translation 
MDP0000147173 
Target:MDP0000180494 
Target Start:690 
Target End:709 
miRNA Aligned Fragment:5'-CUCUCCCUCAAAGGCUUCCA-3' 
Target Aligned Fragment:3'- GGGAGGGUGUUUCUGAGGGU -5' 
Inhibition Type:Cleavage 
MDP0000180494 
Target:MDP0000319525 
Target Start:690 
Target End:709 
miRNA Aligned Fragment:5'-CUCUCCCUCAAAGGCUUCCA-3' 
Target Aligned Fragment:3'- GGGAGGGUGUUUCUGAGGGU -5' 
Inhibition Type:Cleavage 
MDP0000319525 
Data resource:
microPC
Wei et al.

All copyright are reserved by Prof. Huairui Shu 's lab at National Research Center for Apple Engineering and Technology,Shandong Agricultrural University

Web Site Designing & Administration Shizhong Zhang,Guanghui Chen and Yukun Liu ; IE 8 & 1600×900 Resolution Suggested