AppleGFDB:The Apple Gene Function & Gene Family DataBase v1.0
Locus Search:

 

miR482

miR482  

Mature Sequence:5'-TCTTCCCAAGCCCGCCCATTCC-3'

Precursor Sequence:

GAGAAGAGGGAAAGGGAGATTGGAGCTGCTGGAAGTTTTAGGAATGGGCTGTTTGGGAAC
AAGGAAATTACCACAATAATTGTCTTGTGGGGTTTCTTCCCAAGCCCGCCCATTCCTATG
ATTTCCAGCTGTTCCTCCCTTTCCCTTGTCTC

Genome Location:UN
Precursor Coordinates:_
MFE:_
MFEI:_
GC:_
Plant Homologs:

_

Structure:
Target:MDP0000171580 
Target Start:610 
Target End:631 
miRNA Aligned Fragment:5'-UCUUCCCAAGCCCGCCCAUUCC-3' 
Target Aligned Fragment:3'- AGAAKGGYUGGGGUGGGUAAGG -5' 
Inhibition Type:Translation 
MDP0000171580 
Target:MDP0000318654 
Target Start:1498 
Target End:1519 
miRNA Aligned Fragment:5'-UCUUCCCAAGCCCGCCCAUUCC-3' 
Target Aligned Fragment:3'- AGAAUGGUUGGGGCGGGUAAGG -5' 
Inhibition Type:Translation 
MDP0000318654 
Target:MDP0000159004 
Target Start:583 
Target End:604 
miRNA Aligned Fragment:5'-UCUUCCCAAGCCCGCCCAUUCC-3' 
Target Aligned Fragment:3'- AGAAGGGAUCAGGUGGGUAAGG -5' 
Inhibition Type:Translation 
MDP0000159004 
Target:MDP0000893454 
Target Start:1111 
Target End:1132 
miRNA Aligned Fragment:5'-UCUUCCCAAGCCCGCCCAUUCC-3' 
Target Aligned Fragment:3'- GGAAGGGUUCGGGAGGUUAGGG -5' 
Inhibition Type:Cleavage 
MDP0000893454 
Target:MDP0000258016 
Target Start:415 
Target End:436 
miRNA Aligned Fragment:5'-UCUUCCCAAGCCCGCCCAUUCC-3' 
Target Aligned Fragment:3'- AGAAGGGGUUUGGCGGGUAGGG -5' 
Inhibition Type:Translation 
MDP0000258016 
Target:MDP0000171580 
Target Start:608 
Target End:631 
miRNA Aligned Fragment:5'-UCUUCCCAAGCCCGCCCAUUCCUA-3' 
Target Aligned Fragment:3'- AGAAKGGYUGGGGUGGGUAAGGGU -5' 
Inhibition Type:Translation 
MDP0000171580 
Target:MDP0000318654 
Target Start:1496 
Target End:1519 
miRNA Aligned Fragment:5'-UCUUCCCAAGCCCGCCCAUUCCUA-3' 
Target Aligned Fragment:3'- AGAAUGGUUGGGGCGGGUAAGGUU -5' 
Inhibition Type:Translation 
MDP0000318654 
Target:MDP0000304705 
Target Start:4628 
Target End:4651 
miRNA Aligned Fragment:5'-UCUUCCCAAGCCCGCCCAUUCCUA-3' 
Target Aligned Fragment:3'- AGAAGGGCUCCGGAGGGUAAGGGU -5' 
Inhibition Type:Translation 
MDP0000304705 
Target:MDP0000159004 
Target Start:583 
Target End:604 
miRNA Aligned Fragment:5'-UCUUCCCAAGCCCGCCCAUUCC-3' 
Target Aligned Fragment:3'- AGAAGGGAUCAGGUGGGUAAGG -5' 
Inhibition Type:Translation 
MDP0000159004 
Target:MDP0000171580 
Target Start:610 
Target End:631 
miRNA Aligned Fragment:5'-UCUUCCCAAGCCCGCCCAUUCC-3' 
Target Aligned Fragment:3'- AGAAKGGYUGGGGUGGGUAAGG -5' 
Inhibition Type:Translation 
MDP0000171580 
Target:MDP0000318654 
Target Start:1498 
Target End:1519 
miRNA Aligned Fragment:5'-UCUUCCCAAGCCCGCCCAUUCC-3' 
Target Aligned Fragment:3'- AGAAUGGUUGGGGCGGGUAAGG -5' 
Inhibition Type:Translation 
MDP0000318654 
Target:MDP0000159004 
Target Start:583 
Target End:604 
miRNA Aligned Fragment:5'-UCUUCCCAAGCCCGCCCAUUCC-3' 
Target Aligned Fragment:3'- AGAAGGGAUCAGGUGGGUAAGG -5' 
Inhibition Type:Translation 
MDP0000159004 
Target:MDP0000893454 
Target Start:1111 
Target End:1132 
miRNA Aligned Fragment:5'-UCUUCCCAAGCCCGCCCAUUCC-3' 
Target Aligned Fragment:3'- GGAAGGGUUCGGGAGGUUAGGG -5' 
Inhibition Type:Cleavage 
MDP0000893454 
Target:MDP0000258016 
Target Start:415 
Target End:436 
miRNA Aligned Fragment:5'-UCUUCCCAAGCCCGCCCAUUCC-3' 
Target Aligned Fragment:3'- AGAAGGGGUUUGGCGGGUAGGG -5' 
Inhibition Type:Translation 
MDP0000258016 
Target:MDP0000171580 
Target Start:608 
Target End:631 
miRNA Aligned Fragment:5'-UCUUCCCAAGCCCGCCCAUUCCUA-3' 
Target Aligned Fragment:3'- AGAAKGGYUGGGGUGGGUAAGGGU -5' 
Inhibition Type:Translation 
MDP0000171580 
Target:MDP0000318654 
Target Start:1496 
Target End:1519 
miRNA Aligned Fragment:5'-UCUUCCCAAGCCCGCCCAUUCCUA-3' 
Target Aligned Fragment:3'- AGAAUGGUUGGGGCGGGUAAGGUU -5' 
Inhibition Type:Translation 
MDP0000318654 
Target:MDP0000304705 
Target Start:4628 
Target End:4651 
miRNA Aligned Fragment:5'-UCUUCCCAAGCCCGCCCAUUCCUA-3' 
Target Aligned Fragment:3'- AGAAGGGCUCCGGAGGGUAAGGGU -5' 
Inhibition Type:Translation 
MDP0000304705 
Target:MDP0000159004 
Target Start:583 
Target End:604 
miRNA Aligned Fragment:5'-UCUUCCCAAGCCCGCCCAUUCC-3' 
Target Aligned Fragment:3'- AGAAGGGAUCAGGUGGGUAAGG -5' 
Inhibition Type:Translation 
MDP0000159004 
Data resource:
Huaping Yu et al.
microPC
mirNEST
PMRD
PMRD

All copyright are reserved by Prof. Huairui Shu 's lab at National Research Center for Apple Engineering and Technology,Shandong Agricultrural University

Web Site Designing & Administration Shizhong Zhang,Guanghui Chen and Yukun Liu ; IE 8 & 1600×900 Resolution Suggested