AppleGFDB:The Apple Gene Function & Gene Family DataBase v1.0
Locus Search:

 

miR482*

miR482*  

Mature Sequence:5'-GGAATGGGCTGTTTGGGAACA-3'

Precursor Sequence:

GAGAAGAGGGAAAGGGAGATTGGAGCTGCTGGAAGTTTTAGGAATGGGCTGTTTGGGAAC
AAGGAAATTACCACAATAATTGTCTTGTGGGGTTTCTTCCCAAGCCCGCCCATTCCTATG
ATTTCCAGCTGTTCCTCCCTTTCCCTTGTCTC

Genome Location:UN
Precursor Coordinates:_
MFE:_
MFEI:_
GC:_
Plant Homologs:

_

Structure:
Target:MDP0000171580 
Target Start:608 
Target End:631 
miRNA Aligned Fragment:5'-UCUUCCCAAGCCCGCCCAUUCCUA-3' 
Target Aligned Fragment:3'- AGAAKGGYUGGGGUGGGUAAGGGU -5' 
Inhibition Type:Translation 
MDP0000171580 
Target:MDP0000318654 
Target Start:1496 
Target End:1519 
miRNA Aligned Fragment:5'-UCUUCCCAAGCCCGCCCAUUCCUA-3' 
Target Aligned Fragment:3'- AGAAUGGUUGGGGCGGGUAAGGUU -5' 
Inhibition Type:Translation 
MDP0000318654 
Target:MDP0000304705 
Target Start:4628 
Target End:4651 
miRNA Aligned Fragment:5'-UCUUCCCAAGCCCGCCCAUUCCUA-3' 
Target Aligned Fragment:3'- AGAAGGGCUCCGGAGGGUAAGGGU -5' 
Inhibition Type:Translation 
MDP0000304705 
Target:MDP0000159004 
Target Start:583 
Target End:604 
miRNA Aligned Fragment:5'-UCUUCCCAAGCCCGCCCAUUCC-3' 
Target Aligned Fragment:3'- AGAAGGGAUCAGGUGGGUAAGG -5' 
Inhibition Type:Translation 
MDP0000159004 
Data resource:
PMRD

All copyright are reserved by Prof. Huairui Shu 's lab at National Research Center for Apple Engineering and Technology,Shandong Agricultrural University

Web Site Designing & Administration Shizhong Zhang,Guanghui Chen and Yukun Liu ; IE 8 & 1600×900 Resolution Suggested