AppleGFDB:The Apple Gene Function & Gene Family DataBase v1.0
Locus Search:

 

miR530a

miR530a  

Mature Sequence:5'-TCTGCATTTGCACCTGCACCT-3'

Precursor Sequence:

GGCAAGGTGGTTTCATTTATCTGCATTTGCACCTGCACCTCTAATTTGGTCTCTGCAGTG
GGGTTTTCCTCACTATCATCATCACATGCACTGCACTGATGTCTGATGATGATGAACTCA
CTCGCTCCCACAGGGATCCATGTAAAGGTGCAGGTGTAACTGCAGACAAAT

Genome Location:Chr5:13958136..13958155
Precursor Coordinates:179..350
MFE:-72.5
MFEI:0.91
GC:46.78
Plant Homologs:

ppt-miR1030d;ppt-miR1030e;ppt-miR1030f;ppt-miR1030i;ppt-miR1030a;ppt-miR1030b;ppt-miR1030g;ppt-miR1030j;ppt-miR1030c;ppt-miR1030h;aqc-miR530;csi-miR530a;csi-miR530b;osa-miR530-5p;ptc-miR530b;ptc-miR530a;

Structure:
Target:MDP0000147872 
Target Start:230 
Target End:249 
miRNA Aligned Fragment:5'-UGCAUUUGCACCUGCACCUC-3' 
Target Aligned Fragment:3'- ACGUAAACGUGGACGUGGAC -5' 
Inhibition Type:Cleavage 
MDP0000147872 
Target:MDP0000196131 
Target Start:365 
Target End:384 
miRNA Aligned Fragment:5'-UGCAUUUGCACCUGCACCUC-3' 
Target Aligned Fragment:3'- ACGUAAACGUGGACGUGGAC -5' 
Inhibition Type:Cleavage 
MDP0000196131 
Target:MDP0000261181 
Target Start:44 
Target End:63 
miRNA Aligned Fragment:5'-UGCAUUUGCACCUGCACCUC-3' 
Target Aligned Fragment:3'- ACGUGGACGUGGACGUGGAG -5' 
Inhibition Type:Cleavage 
MDP0000261181 
Target:MDP0000233288 
Target Start:1172 
Target End:1191 
miRNA Aligned Fragment:5'-UGCAUUUGCACCUGCACCUC-3' 
Target Aligned Fragment:3'- ACGUGAACGUGGACGUGGUG -5' 
Inhibition Type:Cleavage 
MDP0000233288 
Target:MDP0000193325 
Target Start:1631 
Target End:1650 
miRNA Aligned Fragment:5'-UGCAUUUGCACCUGCACCUC-3' 
Target Aligned Fragment:3'- ACGUGGACGUGAACGUGGAG -5' 
Inhibition Type:Cleavage 
MDP0000193325 
Target:MDP0000198217 
Target Start:725 
Target End:744 
miRNA Aligned Fragment:5'-UGCAUUUGCACCUGCACCUC-3' 
Target Aligned Fragment:3'- UCGUGGACGUGGACGUGGAC -5' 
Inhibition Type:Cleavage 
MDP0000198217 
Target:MDP0000837414 
Target Start:334 
Target End:353 
miRNA Aligned Fragment:5'-UGCAUUUGCACCUGCACCUC-3' 
Target Aligned Fragment:3'- UUGUAAACGUGGGCUUGGAG -5' 
Inhibition Type:Cleavage 
MDP0000837414 
Target:MDP0000291809 
Target Start:334 
Target End:353 
miRNA Aligned Fragment:5'-UGCAUUUGCACCUGCACCUC-3' 
Target Aligned Fragment:3'- UUGUAAACGUGGGCUUGGAG -5' 
Inhibition Type:Cleavage 
MDP0000291809 
Target:MDP0000301736 
Target Start:5053 
Target End:5072 
miRNA Aligned Fragment:5'-UGCAUUUGCACCUGCACCUC-3' 
Target Aligned Fragment:3'- ACGUAGACGUGGAGGAGGAG -5' 
Inhibition Type:Cleavage 
MDP0000301736 
Data resource:
Wei et al.

All copyright are reserved by Prof. Huairui Shu 's lab at National Research Center for Apple Engineering and Technology,Shandong Agricultrural University

Web Site Designing & Administration Shizhong Zhang,Guanghui Chen and Yukun Liu ; IE 8 & 1600×900 Resolution Suggested