AppleGFDB:The Apple Gene Function & Gene Family DataBase v1.0
Locus Search:

 

miR574-

miR574-  

Mature Sequence:5'-TGAGTGTGTGTGTGTGAGTGTGT-3'

Precursor Sequence:

_

Genome Location:Chr2:3864195..3864173
Precursor Coordinates:_
MFE:_
MFEI:_
GC:_
Plant Homologs:

_

Structure:
Target:MDP0000368225 
Target Start:6 
Target End:28 
miRNA Aligned Fragment:5'-UGAGUGUGUGUGUGUGAGUGUGU-3' 
Target Aligned Fragment:3'- ACCCACACACACACACACACACA -5' 
Inhibition Type:Cleavage 
MDP0000368225 
Target:MDP0000367489 
Target Start:45 
Target End:67 
miRNA Aligned Fragment:5'-UGAGUGUGUGUGUGUGAGUGUGU-3' 
Target Aligned Fragment:3'- ACUUAGACACACAUAUUCACACA -5' 
Inhibition Type:Cleavage 
MDP0000367489 
Target:MDP0000176447 
Target Start:475 
Target End:497 
miRNA Aligned Fragment:5'-UGAGUGUGUGUGUGUGAGUGUGU-3' 
Target Aligned Fragment:3'- ACACACACACACACACACACACA -5' 
Inhibition Type:Cleavage 
MDP0000176447 
Target:MDP0000442611 
Target Start:800 
Target End:821 
miRNA Aligned Fragment:5'-UGAGUGUGUGUGUGUGAGUGUG-3' 
Target Aligned Fragment:3'- ACUCGUAUACUCACACUCACAC -5' 
Inhibition Type:Translation 
MDP0000442611 
Target:MDP0000328318 
Target Start:947 
Target End:968 
miRNA Aligned Fragment:5'-UGAGUGUGUGUGUGUGAGUGUG-3' 
Target Aligned Fragment:3'- ACUCGUAUACUCACACUCACAC -5' 
Inhibition Type:Translation 
MDP0000328318 
Target:MDP0000260932 
Target Start:1329 
Target End:1351 
miRNA Aligned Fragment:5'-UGAGUGUGUGUGUGUGAGUGUGU-3' 
Target Aligned Fragment:3'- AUACACACACACACACACACAUA -5' 
Inhibition Type:Cleavage 
MDP0000260932 
Target:MDP0000180482 
Target Start:1793 
Target End:1815 
miRNA Aligned Fragment:5'-UGAGUGUGUGUGUGUGAGUGUGU-3' 
Target Aligned Fragment:3'- ACUUACAUGCACCCAUUCACACG -5' 
Inhibition Type:Cleavage 
MDP0000180482 
Target:MDP0000291837 
Target Start:33 
Target End:53 
miRNA Aligned Fragment:5'-UGAGUGUGUGUGUGUGAGUGU-3' 
Target Aligned Fragment:3'- ACCCACACACACACACCCACA -5' 
Inhibition Type:Cleavage 
MDP0000291837 
Target:MDP0000615669 
Target Start:107 
Target End:128 
miRNA Aligned Fragment:5'-UGAGUGUGUGUGUGUGAGUGUG-3' 
Target Aligned Fragment:3'- ACUCAUACACUUGCACUUACGC -5' 
Inhibition Type:Translation 
MDP0000615669 
Target:MDP0000448755 
Target Start:107 
Target End:128 
miRNA Aligned Fragment:5'-UGAGUGUGUGUGUGUGAGUGUG-3' 
Target Aligned Fragment:3'- ACUCAUACACUUGCACUUACGC -5' 
Inhibition Type:Translation 
MDP0000448755 
Target:MDP0000321447 
Target Start:9325 
Target End:9344 
miRNA Aligned Fragment:5'-UGAGUGUGUGUGUGUGAGUG-3' 
Target Aligned Fragment:3'- GCUCAAACACGCACACUCAC -5' 
Inhibition Type:Cleavage 
MDP0000321447 
Data resource:
Wei et al.

All copyright are reserved by Prof. Huairui Shu 's lab at National Research Center for Apple Engineering and Technology,Shandong Agricultrural University

Web Site Designing & Administration Shizhong Zhang,Guanghui Chen and Yukun Liu ; IE 8 & 1600×900 Resolution Suggested