AppleGFDB:The Apple Gene Function & Gene Family DataBase v1.0
Locus Search:

 

miR828a

miR828a  

Mature Sequence:5'-TCTTGCTCAAATGAGTATTCCA-3'

Precursor Sequence:

TACTCCTCTTCGTAATGTTTCTTGCTCAAATGAGTATTCCAGCCACAGTTTGCATGCAGC
TTGCATATATATATATAAGAACATGTATGTGTATATATATATAGCACTGGTGCTTCTGCA
ATCCTGAGATGCTCATTTGGGCAAGCAACGTTACAAGAGGAACATTTTTGCA

Genome Location:Chr1:28316695..28316674
Precursor Coordinates:181..353
MFE:-74.3
MFEI:1.14
GC:37.79
Plant Homologs:

aly-miR828;aly-miR828*;ath-miR828;vvi-miR828a;vvi-miR828b;

Structure:
Target:MDP0000133817 
Target Start:325 
Target End:346 
miRNA Aligned Fragment:5'-UCUUGCUCAAAUGAGUAUUCCA-3' 
Target Aligned Fragment:3'- AGAACGAGUUUACUCUUAAGGU -5' 
Inhibition Type:Cleavage 
MDP0000133817 
Target:MDP0000143276 
Target Start:325 
Target End:346 
miRNA Aligned Fragment:5'-UCUUGCUCAAAUGAGUAUUCCA-3' 
Target Aligned Fragment:3'- AGAACGAGUUUACUCUUAAGGU -5' 
Inhibition Type:Cleavage 
MDP0000143276 
Target:MDP0000124555 
Target Start:367 
Target End:388 
miRNA Aligned Fragment:5'-UCUUGCUCAAAUGAGUAUUCCA-3' 
Target Aligned Fragment:3'- AGAACGAGUUUACUCUUAAGGU -5' 
Inhibition Type:Cleavage 
MDP0000124555 
Target:MDP0000578193 
Target Start:310 
Target End:331 
miRNA Aligned Fragment:5'-UCUUGCUCAAAUGAGUAUUCCA-3' 
Target Aligned Fragment:3'- AGAACGAGUUUACUCACAAGGU -5' 
Inhibition Type:Cleavage 
MDP0000578193 
Target:MDP0000145557 
Target Start:2341 
Target End:2362 
miRNA Aligned Fragment:5'-UCUUGCUCAAAUGAGUAUUCCA-3' 
Target Aligned Fragment:3'- AGAACGAGUUUACUCACGAGGU -5' 
Inhibition Type:Cleavage 
MDP0000145557 
Target:MDP0000193637 
Target Start:307 
Target End:328 
miRNA Aligned Fragment:5'-UCUUGCUCAAAUGAGUAUUCCA-3' 
Target Aligned Fragment:3'- AGAACGAGUUUACUGGYAAGGU -5' 
Inhibition Type:Cleavage 
MDP0000193637 
Target:MDP0000642761 
Target Start:307 
Target End:328 
miRNA Aligned Fragment:5'-UCUUGCUCAAAUGAGUAUUCCA-3' 
Target Aligned Fragment:3'- AGAACGAGUUUACUGGYAAGGU -5' 
Inhibition Type:Cleavage 
MDP0000642761 
Target:MDP0000226215 
Target Start:325 
Target End:346 
miRNA Aligned Fragment:5'-UCUUGCUCAAAUGAGUAUUCCA-3' 
Target Aligned Fragment:3'- AAAACGAGUUUACUCUUAAGGU -5' 
Inhibition Type:Cleavage 
MDP0000226215 
Target:MDP0000253904 
Target Start:325 
Target End:346 
miRNA Aligned Fragment:5'-UCUUGCUCAAAUGAGUAUUCCA-3' 
Target Aligned Fragment:3'- AAAACGAGUUUACUCUUAAGGU -5' 
Inhibition Type:Cleavage 
MDP0000253904 
Target:MDP0000931057 
Target Start:367 
Target End:388 
miRNA Aligned Fragment:5'-UCUUGCUCAAAUGAGUAUUCCA-3' 
Target Aligned Fragment:3'- AAAACGAGUUUACUCUUAAGGU -5' 
Inhibition Type:Cleavage 
MDP0000931057 
Target:MDP0000650225 
Target Start:307 
Target End:328 
miRNA Aligned Fragment:5'-UCUUGCUCAAAUGAGUAUUCCA-3' 
Target Aligned Fragment:3'- AGAACGAGUUUACUGACAAGGU -5' 
Inhibition Type:Cleavage 
MDP0000650225 
Target:MDP0000167314 
Target Start:343 
Target End:364 
miRNA Aligned Fragment:5'-UCUUGCUCAAAUGAGUAUUCCA-3' 
Target Aligned Fragment:3'- AGAACAAGUUUACCCAUAAGGU -5' 
Inhibition Type:Cleavage 
MDP0000167314 
Target:MDP0000264051 
Target Start:340 
Target End:361 
miRNA Aligned Fragment:5'-UCUUGCUCAAAUGAGUAUUCCA-3' 
Target Aligned Fragment:3'- AGAACAAGUUUACCCAUAAGGU -5' 
Inhibition Type:Cleavage 
MDP0000264051 
Target:MDP0000581761 
Target Start:148 
Target End:169 
miRNA Aligned Fragment:5'-UCUUGCUCAAAUGAGUAUUCCA-3' 
Target Aligned Fragment:3'- AGGACGACUCUACUCAUAAGGU -5' 
Inhibition Type:Translation 
MDP0000581761 
Target:MDP0000164048 
Target Start:307 
Target End:328 
miRNA Aligned Fragment:5'-UCUUGCUCAAAUGAGUAUUCCA-3' 
Target Aligned Fragment:3'- AAAACGAGUUUACUCGCAAGGU -5' 
Inhibition Type:Cleavage 
MDP0000164048 
Target:MDP0000268980 
Target Start:973 
Target End:994 
miRNA Aligned Fragment:5'-UCUUGCUCAAAUGAGUAUUCCA-3' 
Target Aligned Fragment:3'- AGGACGAGUUCACUCUUAAGGU -5' 
Inhibition Type:Translation 
MDP0000268980 
Target:MDP0000317209 
Target Start:322 
Target End:343 
miRNA Aligned Fragment:5'-UCUUGCUCAAAUGAGUAUUCCA-3' 
Target Aligned Fragment:3'- AGAACGAGUUUGACUAUAAGGU -5' 
Inhibition Type:Cleavage 
MDP0000317209 
Target:MDP0000475808 
Target Start:232 
Target End:253 
miRNA Aligned Fragment:5'-UCUUGCUCAAAUGAGUAUUCCA-3' 
Target Aligned Fragment:3'- AGAACGAGUUUGACUAUAAGGU -5' 
Inhibition Type:Cleavage 
MDP0000475808 
Target:MDP0000726027 
Target Start:339 
Target End:358 
miRNA Aligned Fragment:5'-UCUUGCUCAAAUGAGUAUUC-3' 
Target Aligned Fragment:3'- AGAAGGAGUUUACUCAAAAG -5' 
Inhibition Type:Cleavage 
MDP0000726027 
Data resource:
Huaping Yu et al.
Wei et al.

All copyright are reserved by Prof. Huairui Shu 's lab at National Research Center for Apple Engineering and Technology,Shandong Agricultrural University

Web Site Designing & Administration Shizhong Zhang,Guanghui Chen and Yukun Liu ; IE 8 & 1600×900 Resolution Suggested