AppleGFDB:The Apple Gene Function & Gene Family DataBase v1.0
Locus Search:

 

miR828b

miR828b  

Mature Sequence:5'-TCTTGCTCAAATGAGTGTTCCA-3'

Precursor Sequence:

_

Genome Location:Chr6:19670777..19670798
Precursor Coordinates:_
MFE:_
MFEI:_
GC:_
Plant Homologs:

_

Structure:
Target:MDP0000578193 
Target Start:310 
Target End:331 
miRNA Aligned Fragment:5'-UCUUGCUCAAAUGAGUGUUCCA-3' 
Target Aligned Fragment:3'- AGAACGAGUUUACUCACAAGGU -5' 
Inhibition Type:Cleavage 
MDP0000578193 
Target:MDP0000145557 
Target Start:2341 
Target End:2362 
miRNA Aligned Fragment:5'-UCUUGCUCAAAUGAGUGUUCCA-3' 
Target Aligned Fragment:3'- AGAACGAGUUUACUCACGAGGU -5' 
Inhibition Type:Cleavage 
MDP0000145557 
Target:MDP0000650225 
Target Start:307 
Target End:328 
miRNA Aligned Fragment:5'-UCUUGCUCAAAUGAGUGUUCCA-3' 
Target Aligned Fragment:3'- AGAACGAGUUUACUGACAAGGU -5' 
Inhibition Type:Cleavage 
MDP0000650225 
Target:MDP0000143276 
Target Start:325 
Target End:346 
miRNA Aligned Fragment:5'-UCUUGCUCAAAUGAGUGUUCCA-3' 
Target Aligned Fragment:3'- AGAACGAGUUUACUCUUAAGGU -5' 
Inhibition Type:Cleavage 
MDP0000143276 
Target:MDP0000133817 
Target Start:325 
Target End:346 
miRNA Aligned Fragment:5'-UCUUGCUCAAAUGAGUGUUCCA-3' 
Target Aligned Fragment:3'- AGAACGAGUUUACUCUUAAGGU -5' 
Inhibition Type:Cleavage 
MDP0000133817 
Target:MDP0000164048 
Target Start:307 
Target End:328 
miRNA Aligned Fragment:5'-UCUUGCUCAAAUGAGUGUUCCA-3' 
Target Aligned Fragment:3'- AAAACGAGUUUACUCGCAAGGU -5' 
Inhibition Type:Cleavage 
MDP0000164048 
Target:MDP0000124555 
Target Start:367 
Target End:388 
miRNA Aligned Fragment:5'-UCUUGCUCAAAUGAGUGUUCCA-3' 
Target Aligned Fragment:3'- AGAACGAGUUUACUCUUAAGGU -5' 
Inhibition Type:Cleavage 
MDP0000124555 
Target:MDP0000193637 
Target Start:307 
Target End:328 
miRNA Aligned Fragment:5'-UCUUGCUCAAAUGAGUGUUCCA-3' 
Target Aligned Fragment:3'- AGAACGAGUUUACUGGYAAGGU -5' 
Inhibition Type:Cleavage 
MDP0000193637 
Target:MDP0000642761 
Target Start:307 
Target End:328 
miRNA Aligned Fragment:5'-UCUUGCUCAAAUGAGUGUUCCA-3' 
Target Aligned Fragment:3'- AGAACGAGUUUACUGGYAAGGU -5' 
Inhibition Type:Cleavage 
MDP0000642761 
Target:MDP0000261265 
Target Start:325 
Target End:346 
miRNA Aligned Fragment:5'-UCUUGCUCAAAUGAGUGUUCCA-3' 
Target Aligned Fragment:3'- AAAACGAGUUUACUCUCAAGGU -5' 
Inhibition Type:Cleavage 
MDP0000261265 
Target:MDP0000253904 
Target Start:325 
Target End:346 
miRNA Aligned Fragment:5'-UCUUGCUCAAAUGAGUGUUCCA-3' 
Target Aligned Fragment:3'- AAAACGAGUUUACUCUUAAGGU -5' 
Inhibition Type:Cleavage 
MDP0000253904 
Target:MDP0000226215 
Target Start:325 
Target End:346 
miRNA Aligned Fragment:5'-UCUUGCUCAAAUGAGUGUUCCA-3' 
Target Aligned Fragment:3'- AAAACGAGUUUACUCUUAAGGU -5' 
Inhibition Type:Cleavage 
MDP0000226215 
Target:MDP0000931057 
Target Start:367 
Target End:388 
miRNA Aligned Fragment:5'-UCUUGCUCAAAUGAGUGUUCCA-3' 
Target Aligned Fragment:3'- AAAACGAGUUUACUCUUAAGGU -5' 
Inhibition Type:Cleavage 
MDP0000931057 
Target:MDP0000167314 
Target Start:343 
Target End:364 
miRNA Aligned Fragment:5'-UCUUGCUCAAAUGAGUGUUCCA-3' 
Target Aligned Fragment:3'- AGAACAAGUUUACCCAUAAGGU -5' 
Inhibition Type:Cleavage 
MDP0000167314 
Target:MDP0000264051 
Target Start:340 
Target End:361 
miRNA Aligned Fragment:5'-UCUUGCUCAAAUGAGUGUUCCA-3' 
Target Aligned Fragment:3'- AGAACAAGUUUACCCAUAAGGU -5' 
Inhibition Type:Cleavage 
MDP0000264051 
Target:MDP0000581761 
Target Start:148 
Target End:169 
miRNA Aligned Fragment:5'-UCUUGCUCAAAUGAGUGUUCCA-3' 
Target Aligned Fragment:3'- AGGACGACUCUACUCAUAAGGU -5' 
Inhibition Type:Translation 
MDP0000581761 
Target:MDP0000268980 
Target Start:973 
Target End:994 
miRNA Aligned Fragment:5'-UCUUGCUCAAAUGAGUGUUCCA-3' 
Target Aligned Fragment:3'- AGGACGAGUUCACUCUUAAGGU -5' 
Inhibition Type:Translation 
MDP0000268980 
Data resource:
Wei et al.

All copyright are reserved by Prof. Huairui Shu 's lab at National Research Center for Apple Engineering and Technology,Shandong Agricultrural University

Web Site Designing & Administration Shizhong Zhang,Guanghui Chen and Yukun Liu ; IE 8 & 1600×900 Resolution Suggested