AppleGFDB:The Apple Gene Function & Gene Family DataBase v1.0
Locus Search:

 

miR845

miR845  

Mature Sequence:5'-AGGCTCTGATACCACTTGTTG-3'

Precursor Sequence:

_

Genome Location:UN
Precursor Coordinates:_
MFE:_
MFEI:_
GC:_
Plant Homologs:

_

Structure:
Target:MDP0000799613 
Target Start:11 
Target End:31 
miRNA Aligned Fragment:5'-AGGCUCUGAUACCAAUUGAUG-3' 
Target Aligned Fragment:3'- UGCGAGACUAUGGUUGACUAC -5' 
Inhibition Type:Cleavage 
MDP0000799613 
Target:MDP0000226112 
Target Start:1390 
Target End:1409 
miRNA Aligned Fragment:5'-AGGCUCUGAUACCAAUUGAU-3' 
Target Aligned Fragment:3'- UCUGAGACUAUGGUUGACUC -5' 
Inhibition Type:Cleavage 
MDP0000226112 
Target:MDP0000167183 
Target Start:12 
Target End:32 
miRNA Aligned Fragment:5'-AGGCUCUGAUACCAAUUGAUG-3' 
Target Aligned Fragment:3'- ACCGAGACCAUGGUUAACUAU -5' 
Inhibition Type:Translation 
MDP0000167183 
Target:MDP0000162922 
Target Start:12 
Target End:32 
miRNA Aligned Fragment:5'-AGGCUCUGAUACCAAUUGAUG-3' 
Target Aligned Fragment:3'- ACCGAGACCAUGGUUAACUAU -5' 
Inhibition Type:Translation 
MDP0000162922 
Target:MDP0000294230 
Target Start:1009 
Target End:1028 
miRNA Aligned Fragment:5'-AGGCUCUGAUACCAAUUGAU-3' 
Target Aligned Fragment:3'- UCUGAGACUGUGGUUGACUC -5' 
Inhibition Type:Cleavage 
MDP0000294230 
Target:MDP0000321985 
Target Start:1853 
Target End:1873 
miRNA Aligned Fragment:5'-AGGCUCUGAUACCAAUUGAUG-3' 
Target Aligned Fragment:3'- CCCGAGGUUAAGGUUAACUAC -5' 
Inhibition Type:Translation 
MDP0000321985 
Target:MDP0000563909 
Target Start:195 
Target End:215 
miRNA Aligned Fragment:5'-AGGCUCUGAUACCAAUUGAUG-3' 
Target Aligned Fragment:3'- CCCGAGACUAUGGUGAACAAU -5' 
Inhibition Type:Cleavage 
MDP0000563909 
Target:MDP0000123078 
Target Start:485 
Target End:504 
miRNA Aligned Fragment:5'-AGGCUCUGAUACCAAUUGAU-3' 
Target Aligned Fragment:3'- UCCGAGGCUAUGGCAAACUA -5' 
Inhibition Type:Cleavage 
MDP0000123078 
Target:MDP0000400398 
Target Start:2097 
Target End:2117 
miRNA Aligned Fragment:5'-AGGCUCUGAUACCAAUUGAUG-3' 
Target Aligned Fragment:3'- CCCGAGACUAUGGUGAACAAU -5' 
Inhibition Type:Cleavage 
MDP0000400398 
Target:MDP0000254943 
Target Start:491 
Target End:510 
miRNA Aligned Fragment:5'-AGGCUCUGAUACCAAUUGAU-3' 
Target Aligned Fragment:3'- UCCGAGGCUAUGGCAAACUA -5' 
Inhibition Type:Cleavage 
MDP0000254943 
Target:MDP0000563909 
Target Start:195 
Target End:215 
miRNA Aligned Fragment:5'-AGGCUCUGAUACCACUUGUUG-3' 
Target Aligned Fragment:3'- CCCGAGACUAUGGUGAACAAU -5' 
Inhibition Type:Cleavage 
MDP0000563909 
Target:MDP0000400398 
Target Start:2097 
Target End:2117 
miRNA Aligned Fragment:5'-AGGCUCUGAUACCACUUGUUG-3' 
Target Aligned Fragment:3'- CCCGAGACUAUGGUGAACAAU -5' 
Inhibition Type:Cleavage 
MDP0000400398 
Target:MDP0000126225 
Target Start:13 
Target End:33 
miRNA Aligned Fragment:5'-AGGCUCUGAUACCACUUGUUG-3' 
Target Aligned Fragment:3'- UUCGAAACUAUGGUGAACAAC -5' 
Inhibition Type:Cleavage 
MDP0000126225 
Target:MDP0000752263 
Target Start:1290 
Target End:1310 
miRNA Aligned Fragment:5'-AGGCUCUGAUACCACUUGUUG-3' 
Target Aligned Fragment:3'- UCCGAGACUAURGUAAACAGU -5' 
Inhibition Type:Cleavage 
MDP0000752263 
Target:MDP0000601282 
Target Start:939 
Target End:959 
miRNA Aligned Fragment:5'-AGGCUCUGAUACCACUUGUUG-3' 
Target Aligned Fragment:3'- WCCGAGACUAUGGUCGACAGU -5' 
Inhibition Type:Cleavage 
MDP0000601282 
Target:MDP0000139654 
Target Start:425 
Target End:444 
miRNA Aligned Fragment:5'-AGGCUCUGAUACCACUUGUU-3' 
Target Aligned Fragment:3'- UCUGAGUCUAUGCUGAACAA -5' 
Inhibition Type:Cleavage 
MDP0000139654 
Target:MDP0000800539 
Target Start:1027 
Target End:1046 
miRNA Aligned Fragment:5'-AGGCUCUGAUACCACUUGUU-3' 
Target Aligned Fragment:3'- ACCGAGACUAGGGUGAAGAA -5' 
Inhibition Type:Translation 
MDP0000800539 
Target:MDP0000236127 
Target Start:1492 
Target End:1511 
miRNA Aligned Fragment:5'-AGGCUCUGAUACCACUUGUU-3' 
Target Aligned Fragment:3'- ACCGAGACUAGGGUGAAGAA -5' 
Inhibition Type:Translation 
MDP0000236127 
Target:MDP0000274894 
Target Start:357 
Target End:376 
miRNA Aligned Fragment:5'-AGGCUCUGAUACCACUUGUU-3' 
Target Aligned Fragment:3'- UUUGAGACUCUGGUGAACUA -5' 
Inhibition Type:Translation 
MDP0000274894 
Target:MDP0000170488 
Target Start:431 
Target End:450 
miRNA Aligned Fragment:5'-AGGCUCUGAUACCACUUGUU-3' 
Target Aligned Fragment:3'- UUUGAGACUAGGGUGAACUA -5' 
Inhibition Type:Translation 
MDP0000170488 
Target:MDP0000312055 
Target Start:1986 
Target End:2005 
miRNA Aligned Fragment:5'-AGGCUCUGAUACCACUUGUU-3' 
Target Aligned Fragment:3'- UUUGAGACUCUGGUGAACUA -5' 
Inhibition Type:Translation 
MDP0000312055 
Data resource:
Huaping Yu et al.
Wei et al.

All copyright are reserved by Prof. Huairui Shu 's lab at National Research Center for Apple Engineering and Technology,Shandong Agricultrural University

Web Site Designing & Administration Shizhong Zhang,Guanghui Chen and Yukun Liu ; IE 8 & 1600×900 Resolution Suggested