AppleGFDB:The Apple Gene Function & Gene Family DataBase v1.0
Locus Search:

 

miR845c

miR845c  

Mature Sequence:5'-AGGCTCTGATACCAATTGATG-3'

Precursor Sequence:

_

Genome Location:Chr2:24872840..24872860
Precursor Coordinates:_
MFE:_
MFEI:_
GC:_
Plant Homologs:

_

Structure:
Target:MDP0000799613 
Target Start:11 
Target End:31 
miRNA Aligned Fragment:5'-AGGCUCUGAUACCAAUUGAUG-3' 
Target Aligned Fragment:3'- UGCGAGACUAUGGUUGACUAC -5' 
Inhibition Type:Cleavage 
MDP0000799613 
Target:MDP0000226112 
Target Start:1390 
Target End:1409 
miRNA Aligned Fragment:5'-AGGCUCUGAUACCAAUUGAU-3' 
Target Aligned Fragment:3'- UCUGAGACUAUGGUUGACUC -5' 
Inhibition Type:Cleavage 
MDP0000226112 
Target:MDP0000167183 
Target Start:12 
Target End:32 
miRNA Aligned Fragment:5'-AGGCUCUGAUACCAAUUGAUG-3' 
Target Aligned Fragment:3'- ACCGAGACCAUGGUUAACUAU -5' 
Inhibition Type:Translation 
MDP0000167183 
Target:MDP0000162922 
Target Start:12 
Target End:32 
miRNA Aligned Fragment:5'-AGGCUCUGAUACCAAUUGAUG-3' 
Target Aligned Fragment:3'- ACCGAGACCAUGGUUAACUAU -5' 
Inhibition Type:Translation 
MDP0000162922 
Target:MDP0000294230 
Target Start:1009 
Target End:1028 
miRNA Aligned Fragment:5'-AGGCUCUGAUACCAAUUGAU-3' 
Target Aligned Fragment:3'- UCUGAGACUGUGGUUGACUC -5' 
Inhibition Type:Cleavage 
MDP0000294230 
Target:MDP0000321985 
Target Start:1853 
Target End:1873 
miRNA Aligned Fragment:5'-AGGCUCUGAUACCAAUUGAUG-3' 
Target Aligned Fragment:3'- CCCGAGGUUAAGGUUAACUAC -5' 
Inhibition Type:Translation 
MDP0000321985 
Target:MDP0000563909 
Target Start:195 
Target End:215 
miRNA Aligned Fragment:5'-AGGCUCUGAUACCAAUUGAUG-3' 
Target Aligned Fragment:3'- CCCGAGACUAUGGUGAACAAU -5' 
Inhibition Type:Cleavage 
MDP0000563909 
Target:MDP0000123078 
Target Start:485 
Target End:504 
miRNA Aligned Fragment:5'-AGGCUCUGAUACCAAUUGAU-3' 
Target Aligned Fragment:3'- UCCGAGGCUAUGGCAAACUA -5' 
Inhibition Type:Cleavage 
MDP0000123078 
Target:MDP0000400398 
Target Start:2097 
Target End:2117 
miRNA Aligned Fragment:5'-AGGCUCUGAUACCAAUUGAUG-3' 
Target Aligned Fragment:3'- CCCGAGACUAUGGUGAACAAU -5' 
Inhibition Type:Cleavage 
MDP0000400398 
Target:MDP0000254943 
Target Start:491 
Target End:510 
miRNA Aligned Fragment:5'-AGGCUCUGAUACCAAUUGAU-3' 
Target Aligned Fragment:3'- UCCGAGGCUAUGGCAAACUA -5' 
Inhibition Type:Cleavage 
MDP0000254943 
Data resource:
Wei et al.

All copyright are reserved by Prof. Huairui Shu 's lab at National Research Center for Apple Engineering and Technology,Shandong Agricultrural University

Web Site Designing & Administration Shizhong Zhang,Guanghui Chen and Yukun Liu ; IE 8 & 1600×900 Resolution Suggested