AppleGFDB:The Apple Gene Function & Gene Family DataBase v1.0
Locus Search:

 

miRNA Data Sheet
 
ID Sequence
miR156

UUGACAGAAGAUAGAGAGCAC
miR159 UUUGGAUUGAAGGGAGCUCUA
miR160 UGCCUGGCUCCCUGUAUGCCA
miR162 UCGAUAAACCUCUGCAUCCAG
miR164 UGGAGAAGCAGGGCACGUGCA
miR166 UCGGACCAGGCUUCAUUCCCC
miR167 UGAAGCUGCCAGCAUGAUCUU
miR172 AGAAUCUUGAUGAUGCUGCAU
miR393 UCCAAAGGGAUCGCAUUGAUC
miR394 UUGGCAUUGCGUCCUCCUCC
miR398 UGUGUUCUCAGGUCGCCCCUG
miR399 UGCCAAAGGAGAUUUGCCC
miR477 CUCUCCCUCAAGGGCUUCGA
miR482 UCUUCCCAAGCCCGCCCAUUCCUA
miR828 UCUUGCUCAAAUGAGUGCUACA
miR845 AGGCUCUGAUACCACUUGUUG
miR1046 CUUGUUUGUGACGAAGUUU
miR1535 UGGAUUUCAUAUUUUGCUAG
miR1888 GAAGUUAAGAUUUGGGCAGAA
miR2101 AUUUAACUCAAAUGUGCAAUGU